ID: 1200244773

View in Genome Browser
Species Human (GRCh38)
Location X:154517142-154517164
Sequence CGGGCACCATTTGGAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244773_1200244779 -3 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244779 X:154517162-154517184 CCGGCACCCAGCTGGCTGTATGG No data
1200244773_1200244783 4 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244783 X:154517169-154517191 CCAGCTGGCTGTATGGACCTGGG No data
1200244773_1200244788 22 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG No data
1200244773_1200244785 8 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244785 X:154517173-154517195 CTGGCTGTATGGACCTGGGGTGG No data
1200244773_1200244786 15 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244773_1200244781 3 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244781 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
1200244773_1200244784 5 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244773 Original CRISPR CGGGCACCATTTGGAGCCGC TGG (reversed) Intergenic