ID: 1200244775

View in Genome Browser
Species Human (GRCh38)
Location X:154517151-154517173
Sequence GCTGGGTGCCGGGCACCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244775_1200244792 30 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244775_1200244786 6 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244775_1200244789 22 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244775_1200244788 13 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG No data
1200244775_1200244785 -1 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244785 X:154517173-154517195 CTGGCTGTATGGACCTGGGGTGG No data
1200244775_1200244783 -5 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244783 X:154517169-154517191 CCAGCTGGCTGTATGGACCTGGG No data
1200244775_1200244784 -4 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data
1200244775_1200244781 -6 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244781 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244775 Original CRISPR GCTGGGTGCCGGGCACCATT TGG (reversed) Intergenic