ID: 1200244776

View in Genome Browser
Species Human (GRCh38)
Location X:154517154-154517176
Sequence AATGGTGCCCGGCACCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244772_1200244776 -10 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244776 X:154517154-154517176 AATGGTGCCCGGCACCCAGCTGG No data
1200244769_1200244776 14 Left 1200244769 X:154517117-154517139 CCAGAAAGAGCGGTGCTTGGCTT No data
Right 1200244776 X:154517154-154517176 AATGGTGCCCGGCACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244776 Original CRISPR AATGGTGCCCGGCACCCAGC TGG Intergenic