ID: 1200244777

View in Genome Browser
Species Human (GRCh38)
Location X:154517161-154517183
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244777_1200244789 12 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244777_1200244786 -4 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244777_1200244788 3 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG No data
1200244777_1200244792 20 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244777 Original CRISPR CATACAGCCAGCTGGGTGCC GGG (reversed) Intergenic