ID: 1200244780

View in Genome Browser
Species Human (GRCh38)
Location X:154517168-154517190
Sequence CCAGGTCCATACAGCCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244780_1200244792 13 Left 1200244780 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244780_1200244789 5 Left 1200244780 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244780_1200244788 -4 Left 1200244780 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
Right 1200244788 X:154517187-154517209 CTGGGGTGGTCTCCGGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244780 Original CRISPR CCAGGTCCATACAGCCAGCT GGG (reversed) Intergenic