ID: 1200244784

View in Genome Browser
Species Human (GRCh38)
Location X:154517170-154517192
Sequence CAGCTGGCTGTATGGACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244769_1200244784 30 Left 1200244769 X:154517117-154517139 CCAGAAAGAGCGGTGCTTGGCTT No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data
1200244773_1200244784 5 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data
1200244775_1200244784 -4 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data
1200244772_1200244784 6 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244784 X:154517170-154517192 CAGCTGGCTGTATGGACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244784 Original CRISPR CAGCTGGCTGTATGGACCTG GGG Intergenic