ID: 1200244786

View in Genome Browser
Species Human (GRCh38)
Location X:154517180-154517202
Sequence TATGGACCTGGGGTGGTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244773_1200244786 15 Left 1200244773 X:154517142-154517164 CCAGCGGCTCCAAATGGTGCCCG No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244772_1200244786 16 Left 1200244772 X:154517141-154517163 CCCAGCGGCTCCAAATGGTGCCC No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244777_1200244786 -4 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244775_1200244786 6 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data
1200244778_1200244786 -5 Left 1200244778 X:154517162-154517184 CCGGCACCCAGCTGGCTGTATGG No data
Right 1200244786 X:154517180-154517202 TATGGACCTGGGGTGGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244786 Original CRISPR TATGGACCTGGGGTGGTCTC CGG Intergenic