ID: 1200244787 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:154517186-154517208 |
| Sequence | CTGCGGCCGGAGACCACCCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1200244787_1200244792 | -5 | Left | 1200244787 | X:154517186-154517208 | CCTGGGGTGGTCTCCGGCCGCAG | No data | ||
| Right | 1200244792 | X:154517204-154517226 | CGCAGGCAGACGCGGCCCTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1200244787 | Original CRISPR | CTGCGGCCGGAGACCACCCC AGG (reversed) | Intergenic | ||