ID: 1200244787

View in Genome Browser
Species Human (GRCh38)
Location X:154517186-154517208
Sequence CTGCGGCCGGAGACCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244787_1200244792 -5 Left 1200244787 X:154517186-154517208 CCTGGGGTGGTCTCCGGCCGCAG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244787 Original CRISPR CTGCGGCCGGAGACCACCCC AGG (reversed) Intergenic