ID: 1200244789

View in Genome Browser
Species Human (GRCh38)
Location X:154517196-154517218
Sequence TCTCCGGCCGCAGGCAGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244780_1200244789 5 Left 1200244780 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244782_1200244789 4 Left 1200244782 X:154517169-154517191 CCAGCTGGCTGTATGGACCTGGG No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244777_1200244789 12 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244775_1200244789 22 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data
1200244778_1200244789 11 Left 1200244778 X:154517162-154517184 CCGGCACCCAGCTGGCTGTATGG No data
Right 1200244789 X:154517196-154517218 TCTCCGGCCGCAGGCAGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244789 Original CRISPR TCTCCGGCCGCAGGCAGACG CGG Intergenic