ID: 1200244792

View in Genome Browser
Species Human (GRCh38)
Location X:154517204-154517226
Sequence CGCAGGCAGACGCGGCCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200244777_1200244792 20 Left 1200244777 X:154517161-154517183 CCCGGCACCCAGCTGGCTGTATG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244782_1200244792 12 Left 1200244782 X:154517169-154517191 CCAGCTGGCTGTATGGACCTGGG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244775_1200244792 30 Left 1200244775 X:154517151-154517173 CCAAATGGTGCCCGGCACCCAGC No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244780_1200244792 13 Left 1200244780 X:154517168-154517190 CCCAGCTGGCTGTATGGACCTGG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244778_1200244792 19 Left 1200244778 X:154517162-154517184 CCGGCACCCAGCTGGCTGTATGG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data
1200244787_1200244792 -5 Left 1200244787 X:154517186-154517208 CCTGGGGTGGTCTCCGGCCGCAG No data
Right 1200244792 X:154517204-154517226 CGCAGGCAGACGCGGCCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200244792 Original CRISPR CGCAGGCAGACGCGGCCCTT CGG Intergenic