ID: 1200246109

View in Genome Browser
Species Human (GRCh38)
Location X:154526664-154526686
Sequence GGGTGGGCAAAGGCAACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200246099_1200246109 14 Left 1200246099 X:154526627-154526649 CCTCTTCGCTTTATAGGGCTGTC No data
Right 1200246109 X:154526664-154526686 GGGTGGGCAAAGGCAACTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200246109 Original CRISPR GGGTGGGCAAAGGCAACTTG GGG Intergenic
No off target data available for this crispr