ID: 1200246689

View in Genome Browser
Species Human (GRCh38)
Location X:154530284-154530306
Sequence GCACCTCTTGAGTTTTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200246689_1200246699 22 Left 1200246689 X:154530284-154530306 CCCTCTGAAAACTCAAGAGGTGC No data
Right 1200246699 X:154530329-154530351 AAGAGCAAGAATTGAACACCGGG No data
1200246689_1200246691 -8 Left 1200246689 X:154530284-154530306 CCCTCTGAAAACTCAAGAGGTGC No data
Right 1200246691 X:154530299-154530321 AGAGGTGCCACTCCCCATTCAGG No data
1200246689_1200246694 -1 Left 1200246689 X:154530284-154530306 CCCTCTGAAAACTCAAGAGGTGC No data
Right 1200246694 X:154530306-154530328 CCACTCCCCATTCAGGGCACAGG No data
1200246689_1200246698 21 Left 1200246689 X:154530284-154530306 CCCTCTGAAAACTCAAGAGGTGC No data
Right 1200246698 X:154530328-154530350 GAAGAGCAAGAATTGAACACCGG No data
1200246689_1200246692 -7 Left 1200246689 X:154530284-154530306 CCCTCTGAAAACTCAAGAGGTGC No data
Right 1200246692 X:154530300-154530322 GAGGTGCCACTCCCCATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200246689 Original CRISPR GCACCTCTTGAGTTTTCAGA GGG (reversed) Intergenic
No off target data available for this crispr