ID: 1200246721

View in Genome Browser
Species Human (GRCh38)
Location X:154530447-154530469
Sequence TTCCACCCGCAGCACAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200246721_1200246723 -10 Left 1200246721 X:154530447-154530469 CCTCACCTGTGCTGCGGGTGGAA No data
Right 1200246723 X:154530460-154530482 GCGGGTGGAACACTCCTCCCTGG No data
1200246721_1200246728 9 Left 1200246721 X:154530447-154530469 CCTCACCTGTGCTGCGGGTGGAA No data
Right 1200246728 X:154530479-154530501 CTGGCCACTTTCCAGGCCACTGG No data
1200246721_1200246724 2 Left 1200246721 X:154530447-154530469 CCTCACCTGTGCTGCGGGTGGAA No data
Right 1200246724 X:154530472-154530494 CTCCTCCCTGGCCACTTTCCAGG No data
1200246721_1200246732 26 Left 1200246721 X:154530447-154530469 CCTCACCTGTGCTGCGGGTGGAA No data
Right 1200246732 X:154530496-154530518 CACTGGTTTGCTCTCCGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200246721 Original CRISPR TTCCACCCGCAGCACAGGTG AGG (reversed) Intergenic
No off target data available for this crispr