ID: 1200247337

View in Genome Browser
Species Human (GRCh38)
Location X:154533195-154533217
Sequence GCCACAGATGTGCAGCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200247333_1200247337 13 Left 1200247333 X:154533159-154533181 CCTTGGGTGTTGAGTTGGGGTGC 0: 1
1: 0
2: 4
3: 13
4: 133
Right 1200247337 X:154533195-154533217 GCCACAGATGTGCAGCCCTCAGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200247337 Original CRISPR GCCACAGATGTGCAGCCCTC AGG Intronic
900100610 1:960609-960631 GCCACCGCCGAGCAGCCCTCCGG + Exonic
900177693 1:1298113-1298135 GCCACAGCGGTGCCGCCCACAGG - Exonic
905683911 1:39895328-39895350 GTTAGAGAAGTGCAGCCCTCTGG + Intergenic
906253151 1:44326970-44326992 GACACAGGTGTGCACACCTCAGG - Intronic
909244974 1:73269890-73269912 GCTGCAGAGGTGGAGCCCTCAGG + Intergenic
910796837 1:91105876-91105898 TTCACAGATGTGCAACCCTAAGG - Intergenic
912100125 1:106193413-106193435 GCCTCTGGTGTGCAGCCCCCAGG + Intergenic
917954543 1:180080523-180080545 GACACAGATGTGCAGCTTTTGGG - Exonic
920031997 1:203043200-203043222 CCCAGAGATGTGGACCCCTCTGG + Intronic
920446834 1:206024105-206024127 GCCAGGCATGTGCTGCCCTCCGG - Intergenic
920678079 1:208052282-208052304 GTCCCAGATGTGCAGTCTTCTGG + Intronic
921994949 1:221408290-221408312 ACCACAGAGGTGCAAGCCTCAGG - Intergenic
923015384 1:230122375-230122397 GCCACTGATTTGGAGGCCTCAGG - Intronic
1063087274 10:2831248-2831270 GGTACAGATGTGCAGCCCGGAGG + Intergenic
1067348438 10:45455155-45455177 GCCACAGGCATGCAGGCCTCAGG - Exonic
1068821034 10:61377336-61377358 GCCACACTTGAGCAGCCCTTTGG - Intergenic
1071447673 10:85763990-85764012 GCCACAGAGAAGGAGCCCTCTGG + Intronic
1072705066 10:97675257-97675279 AGCAGAGATGTGCAGCCCTCTGG + Exonic
1075728335 10:124622100-124622122 ACAACAGAGATGCAGCCCTCAGG + Exonic
1075824673 10:125345029-125345051 GGCACAGAGCTGCAGCCTTCTGG + Intergenic
1076133342 10:128028642-128028664 GGCACAGCTGAGCAGCCCGCCGG + Intronic
1077269645 11:1669628-1669650 GCCACAGATGTGGAGTCCTGGGG + Intergenic
1077462369 11:2717039-2717061 CCCCCAGATGTCCTGCCCTCTGG + Intronic
1084178285 11:67434576-67434598 GCCACGTATGTGAAGCCCTGGGG - Exonic
1087023957 11:93631618-93631640 GCCAGAGCTGAGCAGCCCTGTGG + Intergenic
1089626337 11:119753500-119753522 ACCACAGATGTGCAGACATGCGG + Intergenic
1090255483 11:125280832-125280854 GCCACAGATGTCCATCACCCTGG - Intronic
1091957551 12:4660071-4660093 GTCAAAGATGTCCAGCCCTCTGG + Intronic
1093785266 12:23185245-23185267 GCGGCAGATGCCCAGCCCTCTGG - Intergenic
1095127569 12:38500126-38500148 GCCACACATCTACAGCCATCTGG + Intergenic
1096895893 12:54820301-54820323 GCCAGAGCTGTGAAGCCCTTAGG - Intergenic
1100121463 12:91373780-91373802 GTCACTGATGTGCAGCCCACTGG + Intergenic
1100480464 12:94973004-94973026 GCCACAGAACTGCAGCCCGGGGG + Intronic
1101998888 12:109544406-109544428 GCCAAAGGTGAGCAGGCCTCTGG + Intergenic
1104826093 12:131710732-131710754 GCCACATGTGTGGAGGCCTCGGG - Intergenic
1112775966 13:102844658-102844680 GCCACAGCTCTGGAACCCTCAGG - Intronic
1113913729 13:113857777-113857799 TCCACAGATGTGAAGCTCTCCGG + Intronic
1114278701 14:21170243-21170265 TCCTCAGAGGTGAAGCCCTCAGG + Intergenic
1114349560 14:21835535-21835557 GCCAGAGCTGAGCAGACCTCAGG - Intergenic
1115433464 14:33347511-33347533 GCCACACCTGTGAAGCCCTCCGG - Intronic
1120461396 14:84801431-84801453 GCCACAGAAGTGTATCCTTCAGG + Intergenic
1122887727 14:104717969-104717991 GCCAAAGATGGGAAGCGCTCAGG - Intronic
1124055019 15:26234402-26234424 GCCACTCACGTGTAGCCCTCTGG + Intergenic
1127034078 15:54895680-54895702 AACTCAGATGTGCAGCCTTCAGG - Intergenic
1129585859 15:76863914-76863936 ACCACACATGGGCAGCACTCTGG + Intronic
1130139876 15:81216144-81216166 GCCACAGATGGTCATCCCCCAGG - Intronic
1131880662 15:96858850-96858872 GACACAGCTGTGCAGGCCCCAGG - Intergenic
1132305365 15:100807977-100807999 GCCACAGCTGAGCAGACATCAGG + Intergenic
1133056556 16:3148252-3148274 GCCACAGATGGGGAGCTCCCGGG + Intronic
1133232298 16:4372459-4372481 GCTACAGATATGCAGCCCTAGGG + Intronic
1134621257 16:15691227-15691249 GACACAGCTGTGCAGGCCACGGG + Exonic
1136063968 16:27746520-27746542 ACCACAATTGTGCAGCCCTCAGG - Intronic
1136277129 16:29185463-29185485 TCCACAGATGCGCAGGGCTCTGG + Intergenic
1138304914 16:55965706-55965728 GCCACTAATGTGCTGGCCTCAGG + Intergenic
1142081505 16:88151508-88151530 TCCACAGATGCGCAGGGCTCTGG + Intergenic
1146456854 17:33015337-33015359 GCCACAGAGGGGCTGCCCTCGGG + Intronic
1147187407 17:38720184-38720206 GCCACAGGTGTGAAGACCTGGGG - Intronic
1147595979 17:41717585-41717607 GAGACAGACGTGCAGCCCTCCGG - Intergenic
1148046704 17:44749107-44749129 GCTACCAGTGTGCAGCCCTCGGG + Intronic
1153521852 18:5961374-5961396 GGCACAGGTGTCCAGCCCTAGGG - Intronic
1153942780 18:9991819-9991841 GCCGCAGGTGTGCGGCGCTCAGG - Intergenic
1155164374 18:23220692-23220714 GCCACACACGGGCTGCCCTCTGG + Intronic
1155807102 18:30185106-30185128 GCCAGAGATGGCCAGCCTTCAGG + Intergenic
1156094353 18:33510955-33510977 CCCAGTGATGTGCAGCCTTCAGG + Intergenic
1156242535 18:35267574-35267596 GCCACAGAGCTGCGGTCCTCCGG - Exonic
1158747492 18:60218230-60218252 GCCAAGGATGTGCAGGCATCAGG + Intergenic
1160015631 18:75138262-75138284 GACACTGAACTGCAGCCCTCTGG - Intergenic
1160208920 18:76859927-76859949 CCCACAGATGTGCCCCACTCAGG - Intronic
1160398425 18:78589446-78589468 ACCACAGATGTGTAACCCTTTGG - Intergenic
1160486701 18:79299885-79299907 GCTGCAGATGGGCAGCTCTCCGG + Intronic
1160846399 19:1168022-1168044 GCCACACAGGTGCACCCCTGGGG + Intronic
1162818414 19:13209296-13209318 GACACAGGTGGGCAGCCCTGTGG - Exonic
1164146577 19:22516290-22516312 GACACAGAGGTGCTGCCCACTGG + Intronic
1165463837 19:35960231-35960253 GCGGCAGATGAGCAGCCCTGAGG + Intergenic
1167439975 19:49502596-49502618 GCCTCAGATGTGTGGCCTTCTGG - Intergenic
1167608840 19:50496532-50496554 GCCACGGGTGTGCCGTCCTCGGG - Intergenic
1168072404 19:53960352-53960374 GCCACAGTTCAGCAGCCCGCTGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926795820 2:16618039-16618061 GCCACAGAGGGGCAGCACTGTGG + Intronic
929454721 2:42057662-42057684 ACCACATATGTGAAGGCCTCTGG + Exonic
933710262 2:85320117-85320139 GGCACAGATGGGCACCCCACAGG + Intronic
935586390 2:104803650-104803672 GAGACAGAAGTGCAGCCCTGAGG + Intergenic
936076217 2:109403451-109403473 GGCACAGAAGTACAGCCCTGAGG - Intronic
936868893 2:117109691-117109713 GCCACTGATTTCCATCCCTCAGG + Intergenic
940485245 2:154289009-154289031 GCTACAGGGGTGCAGCCCTCAGG - Intronic
943950695 2:194129824-194129846 GGGACAGATGGGCAGCCCTTCGG - Intergenic
947362225 2:229357508-229357530 GCCACAGAGGTGCACTCCTCAGG + Intergenic
947550489 2:231041948-231041970 GTCCCAGATGTGCAGCCTTCAGG + Intronic
947960195 2:234229918-234229940 GCCACAGATCCACTGCCCTCAGG - Intergenic
948235095 2:236381600-236381622 GCCCCACATCTGGAGCCCTCAGG + Intronic
948782634 2:240332180-240332202 GGCACAGATGTGCAGCCATCTGG + Intergenic
948864313 2:240767698-240767720 CCCCCAGATGTGCAGACCACAGG + Intronic
1168927946 20:1598406-1598428 ACCACAGATGGGCAGCTCTTAGG - Intronic
1171255121 20:23684634-23684656 GGCAGAGGGGTGCAGCCCTCAGG - Intergenic
1171399838 20:24865709-24865731 GCCACAGATGTTCATGTCTCTGG + Intergenic
1174397048 20:50253140-50253162 GCCTCAGATGAGAAGCCCTGTGG - Intergenic
1175227173 20:57451344-57451366 GCCAAAGATACACAGCCCTCTGG - Intergenic
1175401713 20:58703775-58703797 GCCACAGCTGCACAGCCTTCAGG + Intronic
1177825446 21:26077690-26077712 GCAACAGCTGTGCAACCGTCTGG - Intronic
1177832412 21:26153769-26153791 GCCACAGATGAGAAGTCCTGAGG + Intronic
1178482209 21:32989373-32989395 TCCACAGGTGTGCTGGCCTCTGG - Intergenic
1179306308 21:40156503-40156525 GGCACAGATGTAAAGCACTCAGG - Intronic
1179444720 21:41423207-41423229 ACCACTGATGTCCACCCCTCTGG - Intronic
1180168035 21:46040186-46040208 GGGACAGCTGTGCAGCCCCCGGG - Intergenic
1182470965 22:30548041-30548063 GCCACCTATGTGCATGCCTCTGG - Intergenic
1182518331 22:30871460-30871482 GGCCCAGATGTGCCGCCCTGGGG - Intronic
1182711129 22:32323963-32323985 GCCACACAGGGGCAGCCATCGGG - Intergenic
1183159945 22:36106134-36106156 GCCACAGATGTTGAGCTCTGTGG + Intergenic
1183365819 22:37406393-37406415 TCCCGAGATGTGCAGCCCTCTGG - Intronic
1183429237 22:37755735-37755757 CCCAGAAAGGTGCAGCCCTCAGG - Intronic
1183827642 22:40401015-40401037 CCCGCAGATCTGCAGTCCTCAGG + Intronic
1184198694 22:42950032-42950054 TCCACAGATGTGGAACCCTTGGG - Intronic
1184203371 22:42984712-42984734 GCCACAGCTCTGCAGCCTTTTGG - Intronic
1184897484 22:47419431-47419453 TCCACAGATGTGCAGTGCTGAGG + Intergenic
1185010647 22:48311089-48311111 GCCACACAATTGCAGCCCACGGG + Intergenic
950645273 3:14373340-14373362 GCCAGAGGTGTGCCGCCCACGGG + Intergenic
950681528 3:14588519-14588541 GCCACTGATGTGTACCCTTCTGG + Intergenic
951302897 3:21020244-21020266 GTCACAGATGTGCAGTGGTCAGG + Intergenic
952651899 3:35737332-35737354 GCCACAGATGGCAGGCCCTCTGG + Exonic
954496851 3:50972482-50972504 CCCACAGATGGGCAGCTCTAAGG + Intronic
954506680 3:51082509-51082531 GCCCCAGACATGCAGCTCTCAGG - Intronic
954955881 3:54517948-54517970 ACCTCAGCTTTGCAGCCCTCAGG + Intronic
955610652 3:60753336-60753358 GCTGAAGATGTGCAGCCCTCTGG + Intronic
956528209 3:70187863-70187885 GCCATAGAAGCTCAGCCCTCTGG + Intergenic
962725807 3:138225645-138225667 TCCACAGATGTAATGCCCTCTGG + Intronic
968189071 3:196654388-196654410 TCCATAGAGGTGCAGCCCACAGG - Intronic
968192643 3:196681381-196681403 GACACAGATGTACACCCCTGTGG - Intronic
969246031 4:5933548-5933570 GCCACATAGCTCCAGCCCTCAGG - Intronic
974249286 4:59363294-59363316 GCCACGGAAGTGGGGCCCTCAGG + Intergenic
974628464 4:64453604-64453626 GCTGCAGGTGTGGAGCCCTCAGG - Intergenic
975758997 4:77599488-77599510 TCCACAGATGTGAAACCCTATGG + Intronic
976914431 4:90353112-90353134 GCCTCAGATGTCCACACCTCAGG - Intronic
979430562 4:120624560-120624582 GACACAGATGTGAAGCCCGGGGG + Intergenic
982181418 4:152751622-152751644 CCAACATCTGTGCAGCCCTCAGG - Intronic
982181448 4:152751762-152751784 CCAACATCTGTGCAGCCCTCAGG - Intronic
984041754 4:174743976-174743998 GCCACAGACCGGCAGCCCTCTGG - Intronic
984991722 4:185387684-185387706 GCCACAGATGGACAGCCATAAGG + Intronic
985619095 5:944312-944334 GCCACAGCTGTTGTGCCCTCTGG + Intergenic
986013034 5:3733813-3733835 GGCCCAGAGCTGCAGCCCTCAGG - Intergenic
987338951 5:16922305-16922327 GGCCAAGGTGTGCAGCCCTCTGG - Intronic
992177120 5:74160739-74160761 GGCTGAGATGTGCAGCTCTCAGG - Intergenic
993396488 5:87395998-87396020 TCCACAGATGTGGAACCCACAGG - Intronic
995393155 5:111661107-111661129 GCTGCAGAGGTGGAGCCCTCAGG - Intergenic
995405296 5:111787957-111787979 GCCACAGGTGTGCACCACCCTGG - Intronic
997490051 5:134267556-134267578 GCAACACATGTGCATCTCTCAGG - Intergenic
997699655 5:135888088-135888110 GCCAAACATCTGCAGCTCTCAGG - Exonic
998003897 5:138644601-138644623 CCCACAGATGTGCACCTCACTGG - Intronic
998376986 5:141697808-141697830 CCCACAGATGTGTAGCTCGCAGG + Intergenic
999242470 5:150135953-150135975 GCCACGTATGCACAGCCCTCAGG + Intronic
1002358238 5:178648402-178648424 GCCAGAGAGGAGCAGACCTCAGG + Intergenic
1002604211 5:180372220-180372242 GCCACAGAAATGGAGCTCTCTGG - Intergenic
1004017417 6:11744725-11744747 GAAACAGATGGGCAGCTCTCTGG + Intronic
1004427734 6:15517537-15517559 ACCACAGTGGTGCAGCCCTTGGG - Intronic
1005979992 6:30829378-30829400 GCCACAGCTGTGCATCCTACTGG + Intergenic
1007478354 6:42134035-42134057 GCCACAACTCTGCTGCCCTCTGG - Intronic
1007494256 6:42248732-42248754 GTCAGAGCTGTCCAGCCCTCTGG - Intronic
1010275736 6:73966602-73966624 GCAATGGATGAGCAGCCCTCTGG + Intergenic
1011617296 6:89208843-89208865 CCCTCAGATGTGCAGGCCTCAGG - Intronic
1012439551 6:99250705-99250727 GCCACTGATGAGCAGGACTCTGG - Intergenic
1012615213 6:101269116-101269138 GCCCCAGATAGGCAGCTCTCAGG - Intergenic
1012823038 6:104112607-104112629 GCCACACATCTACAGCCATCTGG + Intergenic
1019168550 6:170115557-170115579 GCCCCAGATATCCAGCCCTGGGG - Intergenic
1019196994 6:170288888-170288910 GCCCCAGACCTGCAGCCTTCAGG - Intronic
1019219083 6:170460813-170460835 GCCTCTGATGTGCAGGCCCCCGG - Intergenic
1019342865 7:516872-516894 GCCACAGAGGCCCAGCCCTGCGG + Intronic
1025227615 7:57178439-57178461 GGCACAGCTGTGCAGCACACTGG - Intergenic
1025230734 7:57201883-57201905 GACACAGCTGTGCAGCACACTGG - Intergenic
1027246874 7:76373553-76373575 ACCACAGATGGGGGGCCCTCAGG - Intergenic
1032401391 7:131626744-131626766 GCCACCTCTGTGCAGGCCTCGGG + Intergenic
1033993029 7:147311379-147311401 GCCTCAGCTGTGCAACCATCTGG - Intronic
1034147450 7:148884895-148884917 GCCACAGCTGAGCCGACCTCCGG - Intergenic
1034572151 7:151964754-151964776 GCCACAGGTGTGCTGTCTTCAGG + Intronic
1035658203 8:1327299-1327321 GCCACAGGTGTGGAGCTCTGAGG - Intergenic
1036802608 8:11803235-11803257 GCCTCAGATGTGTAACCCTCGGG - Intronic
1037054252 8:14418260-14418282 GCCTCAGTTCTCCAGCCCTCAGG - Intronic
1038256290 8:25954292-25954314 GCCACCAACGGGCAGCCCTCTGG - Intronic
1038382607 8:27110855-27110877 GCCACAGATGTTGATCCCACTGG + Intergenic
1040981078 8:53246728-53246750 GACACTGGAGTGCAGCCCTCAGG - Intronic
1044467614 8:92525740-92525762 ACCTCAGATGGGCAGCTCTCAGG - Intergenic
1047033238 8:120906763-120906785 GCCACAAGTGTGCATCCCACAGG - Intergenic
1049763833 8:144343702-144343724 TCCACAGATGTCCATCCCTAGGG + Intergenic
1050243106 9:3658903-3658925 GCCCCAGACATGCAGCTCTCAGG + Intergenic
1052022584 9:23542009-23542031 GGCACAGCTGGGCAGCCCCCAGG - Intergenic
1056854174 9:90110848-90110870 TCCACAGGGGTGGAGCCCTCAGG - Intergenic
1057888053 9:98846025-98846047 TCCACAGCAATGCAGCCCTCAGG - Exonic
1059468385 9:114484199-114484221 GCCTCGGAGGGGCAGCCCTCTGG - Intronic
1060966143 9:127713278-127713300 GCCACAGCTGTGTGGCCCTGGGG + Intronic
1062209432 9:135355815-135355837 GCCCCAGGTGGGCACCCCTCGGG - Intergenic
1186547377 X:10464655-10464677 GAGACAGATGTGCAGCAGTCGGG + Intronic
1194930103 X:99877764-99877786 GCCACACATCTGCAACCATCTGG + Intergenic
1198842244 X:140870244-140870266 GCCACATATTTGCAGCCAACTGG + Intergenic
1200247337 X:154533195-154533217 GCCACAGATGTGCAGCCCTCAGG + Intronic