ID: 1200247401

View in Genome Browser
Species Human (GRCh38)
Location X:154533460-154533482
Sequence TGGTGACTTCTCCGGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200247392_1200247401 14 Left 1200247392 X:154533423-154533445 CCAGGTCACCTCCGGGAGGCCAC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 139
1200247390_1200247401 19 Left 1200247390 X:154533418-154533440 CCAGTCCAGGTCACCTCCGGGAG 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 139
1200247394_1200247401 3 Left 1200247394 X:154533434-154533456 CCGGGAGGCCACGCTGTGCTCAG 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 139
1200247397_1200247401 -5 Left 1200247397 X:154533442-154533464 CCACGCTGTGCTCAGAGGTGGTG 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 139
1200247393_1200247401 6 Left 1200247393 X:154533431-154533453 CCTCCGGGAGGCCACGCTGTGCT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG 0: 1
1: 0
2: 1
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200247401 Original CRISPR TGGTGACTTCTCCGGGGTTG AGG Intronic
900465417 1:2822869-2822891 TGGCGAGTTCTCAGGGGTTCGGG + Intergenic
903023981 1:20413876-20413898 AGCTGCCTTCTCCTGGGTTGGGG - Intergenic
905237266 1:36558753-36558775 TGGTTACTGTTCTGGGGTTGGGG - Intergenic
907457401 1:54584506-54584528 TGGTGACCACTCTCGGGTTGGGG + Intronic
908687589 1:66739484-66739506 TGGTGACTCCTCCGTCGATGGGG - Exonic
914756743 1:150566705-150566727 TGGTGACTTCTTGGGAGTGGGGG - Intergenic
915665117 1:157437477-157437499 TGGTGACTCAGCCAGGGTTGGGG - Intergenic
915789669 1:158654655-158654677 TGGTGACTTCTCGGGGGCTGCGG + Exonic
917500747 1:175582976-175582998 TGCTGGCATCTCGGGGGTTGGGG - Intronic
917837636 1:178953636-178953658 TGGTGCCTTCTCTGCGGGTGGGG - Intergenic
922477762 1:225918613-225918635 TGGTAACTTCTCCCGGGCTGTGG + Intronic
922767359 1:228162995-228163017 TGGTGGCTTCTTTGGGGTGGGGG + Intergenic
924351851 1:243122194-243122216 TGGTGACCTCTTCGGGTCTGTGG + Intergenic
1062876434 10:946590-946612 TGGTAACATGACCGGGGTTGGGG + Intergenic
1063112423 10:3048494-3048516 TGGTGACTGATTCTGGGTTGGGG - Intergenic
1063332456 10:5175128-5175150 TGGGGACTGTTGCGGGGTTGGGG - Intergenic
1064290614 10:14030924-14030946 TTGTGACTGGTCAGGGGTTGTGG - Intronic
1064504601 10:16015004-16015026 TGTTTGCTTCTCAGGGGTTGTGG - Intergenic
1067019908 10:42786286-42786308 TGGTGACCTTTCCGAGTTTGAGG + Intronic
1069564478 10:69454079-69454101 TGGTGCCATCTCTGGGGTTGAGG + Intronic
1070516587 10:77213896-77213918 TGGAGATTTCTCTGAGGTTGGGG - Intronic
1070806798 10:79275480-79275502 TGGCGACTTCTCGGGGCTTTGGG + Intronic
1075851690 10:125593340-125593362 TGGCAACTTCTCAGGAGTTGGGG - Intronic
1076884957 10:133258028-133258050 TGGTGGCTTCTCCCCGGTTGGGG + Intergenic
1077000752 11:321082-321104 TGGAGACTTCCCCTGTGTTGGGG + Intronic
1078873354 11:15369888-15369910 TAGTGACTTCTCCTGTGTAGGGG - Intergenic
1082317623 11:50749149-50749171 TGGGGACTGTTCTGGGGTTGGGG + Intergenic
1084199380 11:67545229-67545251 TGGTGACCTCTCAGAGGTTCAGG + Intergenic
1085017717 11:73186086-73186108 AGAGGACTTCTCCGGAGTTGGGG + Intergenic
1087879737 11:103402197-103402219 GGGAGACTTCTAAGGGGTTGAGG + Intronic
1088907206 11:114163735-114163757 TGGTGCCTTAGCAGGGGTTGGGG + Intronic
1091124515 11:133082817-133082839 TGGCGACCTCTCCGGGTTGGTGG - Intronic
1091992638 12:4968605-4968627 GGGTGAGTTCTCCGGCGTTCAGG - Intergenic
1092911106 12:13145637-13145659 AGGTGACTTCACTGGGGTAGAGG + Intergenic
1093881242 12:24406488-24406510 TGCTGAACTCTCAGGGGTTGGGG - Intergenic
1094860030 12:34453965-34453987 TGGAGACTGCTGTGGGGTTGGGG + Intergenic
1096019071 12:48307215-48307237 GGATGACTTCTGCGAGGTTGAGG - Intergenic
1099523180 12:83689186-83689208 TGGTGACTTTGCTGGGGGTGGGG - Intergenic
1102281833 12:111624620-111624642 TGGTGTCTTCTCGGGGGTGCAGG + Intergenic
1104933543 12:132352907-132352929 TGGTGCCTTCTCTGGGTTTCCGG + Intergenic
1109073812 13:57806606-57806628 TGGTGGCTTCTCCAGGGAGGTGG - Intergenic
1112091588 13:96090021-96090043 TGGAAACTCCTCCGGGGCTGGGG + Intergenic
1114683800 14:24508480-24508502 TGGTGACTTTTCTGGAGTTGGGG + Exonic
1114816089 14:25960421-25960443 TGGGGACTGCTGTGGGGTTGGGG - Intergenic
1117339181 14:54779181-54779203 TGGAGACTTCCCGGGGCTTGTGG + Intronic
1120663061 14:87273732-87273754 TGTTGACTTCTCAGTGCTTGTGG + Intergenic
1125768113 15:42148490-42148512 TGCTGACTTCTACTGGGTAGAGG - Intronic
1125918630 15:43511032-43511054 TGGAGACAACTCCGGGGCTGGGG + Intronic
1128682945 15:69664710-69664732 TGGTGGCTTCTCCGGGCTGGGGG - Intergenic
1130885300 15:88087670-88087692 TGGTGACATCTCTGGGGCTCTGG - Intronic
1131700932 15:94934746-94934768 TGGTGACTTCTATGTGGTTTTGG - Intergenic
1134064572 16:11219587-11219609 TGGTGACTTCTGGGGGGCTGGGG - Intergenic
1137721205 16:50628539-50628561 TGGTCACTTGTCTGGTGTTGGGG - Intronic
1138527548 16:57617801-57617823 GGGTGACATCTCTGGGGCTGTGG + Intronic
1140257736 16:73351264-73351286 CGGTGACCTCTCCCGGATTGGGG - Intergenic
1142147647 16:88499216-88499238 AGGTGACTTTCCCGGGGTGGAGG - Intronic
1143090047 17:4444757-4444779 TGGTGACCTCTCCAGTGTTGGGG + Intronic
1144649854 17:17000575-17000597 TGGTTACTTCTCGGGGGGTGGGG + Intergenic
1146613086 17:34325726-34325748 TGGTGTGTTCTCCAGGGTTGGGG + Intergenic
1146811987 17:35911208-35911230 TGGGGCCTTCTCTTGGGTTGTGG + Intergenic
1147847152 17:43412660-43412682 TGGAGACTTCTTGAGGGTTGGGG + Intergenic
1149517626 17:57292465-57292487 TGGTGACTCCAGTGGGGTTGGGG + Intronic
1149533955 17:57417549-57417571 TTGTGGCTTCTTGGGGGTTGAGG - Intronic
1151106117 17:71618870-71618892 TGGGGACTGTTGCGGGGTTGGGG + Intergenic
1151679445 17:75615829-75615851 CTGTGGCTTCTCCGGGGGTGTGG - Intergenic
1152215513 17:79029525-79029547 TGGTGGCTTTTCAGGGGTAGCGG + Intronic
1152919157 17:83057163-83057185 TGGAGAATTCTCCAGGCTTGTGG - Intergenic
1156021967 18:32609770-32609792 TGGGGACTGCTGTGGGGTTGGGG - Intergenic
1157844125 18:50986746-50986768 GGGTGACTGCTCTGGGGTTGTGG + Exonic
1158488788 18:57891576-57891598 AGGTGGCTGCTCCAGGGTTGTGG + Intergenic
1158721709 18:59931149-59931171 TGGTTACTTCTCCGAGGCTGTGG + Intergenic
1160791570 19:925950-925972 TGGTGATTTGTCTGGGGGTGGGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1164453381 19:28386027-28386049 GGGTCAGTTCTCTGGGGTTGGGG - Intergenic
924983989 2:251764-251786 CGGTGACTTCTCCTGTCTTGAGG - Intronic
927100617 2:19785102-19785124 TTGTCACCTCTCAGGGGTTGAGG - Intergenic
930057476 2:47263247-47263269 TGGAGAATTCTCAGGGGTTTTGG - Intergenic
934814089 2:97309755-97309777 TGGTGCCTTCACGGGGGTGGGGG + Intergenic
935380044 2:102442153-102442175 TAGTGTCTTCTTTGGGGTTGAGG + Intronic
935387075 2:102511117-102511139 TGGTGAATTCTCAGGGATAGAGG - Intronic
935823807 2:106921292-106921314 TGGTGATTTTTCAGGAGTTGGGG - Intergenic
936852565 2:116918367-116918389 TTGTCAGTTCTCTGGGGTTGTGG + Intergenic
937914580 2:127092630-127092652 TGGTGACTTGCCCGGGGCTGCGG - Intronic
939894345 2:147773753-147773775 TGGTGAATTTTCCCAGGTTGCGG - Intergenic
944741459 2:202616807-202616829 GGGGGACTTCTAAGGGGTTGAGG - Intergenic
945990071 2:216388664-216388686 AGGTGACTTCTCTGGGCTGGGGG - Intergenic
948700745 2:239758034-239758056 GGGTGAGTTCTCACGGGTTGTGG + Intergenic
1169843045 20:9960704-9960726 TGGGGACCTGTCGGGGGTTGGGG + Intergenic
1170102792 20:12720777-12720799 TGGTGACTTCCCCAGGGTGCAGG + Intergenic
1180707678 22:17819082-17819104 AGGTGATTTCTCCTGGGTGGCGG + Exonic
1181017702 22:20080556-20080578 TGGGGACGCCTCCGGGGCTGGGG + Intronic
1181632323 22:24157680-24157702 TGGTGACTTGTGTGGGTTTGTGG + Intronic
1182346784 22:29671947-29671969 TGGTGATTTCTGAGGGGCTGGGG + Exonic
954676079 3:52316114-52316136 TGGTGACATCACAGGGGCTGTGG - Intergenic
954870442 3:53763635-53763657 TGGTGACATCTGCAGGATTGAGG + Intronic
956171001 3:66433176-66433198 TGGTGGCTTCTCTGGCGTGGTGG - Intronic
958204233 3:90369532-90369554 TGGGGACTGCTCTGGGGTGGGGG - Intergenic
969302218 4:6303826-6303848 TGGTGTCTTCCCTGAGGTTGAGG + Intergenic
969671070 4:8590719-8590741 TGGGGACTTCTCAGGGCTTCTGG - Intronic
972774069 4:42225314-42225336 TGGTGTCTTCTCTGTGGTTTAGG + Intergenic
976226037 4:82796684-82796706 TGGTGACCTCTAGGGGATTGAGG - Intronic
979948196 4:126860414-126860436 TGGTGACTTCCATGTGGTTGTGG - Intergenic
981375768 4:144013757-144013779 TGGGGACTGCTGTGGGGTTGGGG + Intronic
984146188 4:176064522-176064544 TTTTGCCTTCTCCGGAGTTGGGG - Intergenic
984253212 4:177359187-177359209 TGGTAACTTTTCCAGGGTAGAGG - Intronic
985789867 5:1919901-1919923 TGCAGACTCCTCCGGTGTTGGGG + Intergenic
990901836 5:60759791-60759813 TGGGGACTGCTGTGGGGTTGGGG - Intronic
994321794 5:98403457-98403479 ATGTGACATCTCTGGGGTTGGGG - Intergenic
994535258 5:101022299-101022321 TGGGGACTGTTGCGGGGTTGGGG + Intergenic
995677309 5:114676726-114676748 TGGGGACTGTTGCGGGGTTGGGG + Intergenic
996767164 5:127046155-127046177 TGGTGAATTCTCCATGCTTGTGG - Exonic
997599164 5:135127613-135127635 TGGTGACTTGTGTGGGGATGAGG + Intronic
1002867001 6:1130504-1130526 TGCTGCTTTCTCCGGAGTTGTGG + Intergenic
1005268399 6:24137685-24137707 CGGGGACTGCTGCGGGGTTGGGG - Intronic
1005275272 6:24210433-24210455 TGGTGCCATTTCCTGGGTTGGGG - Intronic
1006210864 6:32393526-32393548 TGGTGACTTCTCATGTGTTAGGG - Intergenic
1006592013 6:35165283-35165305 TGGTGACTTCCCCCAGCTTGGGG - Intergenic
1007397187 6:41584711-41584733 TGGTGCCTCCTCCTGGGTTGGGG + Intronic
1007429513 6:41768614-41768636 TGGTGCCAGCTCTGGGGTTGTGG + Intergenic
1008529734 6:52445452-52445474 TGGGGACTGCTGCGGGGTAGGGG - Intronic
1009586514 6:65613302-65613324 TGGTGACTTCTCCATGGATAAGG + Intronic
1013158895 6:107522410-107522432 TGGTGGCTTCACTGGGATTGAGG + Intronic
1013784027 6:113759332-113759354 TGGTGATTGCTCTGGGGTAGGGG - Intergenic
1017399802 6:154047181-154047203 TGGTGGCTTCTGTGGGGTGGGGG - Intronic
1018302559 6:162418944-162418966 TTGTGACACCTCCAGGGTTGGGG - Intronic
1018444236 6:163840686-163840708 TAGTGACTTCTCGGGAGTGGGGG + Intergenic
1018719670 6:166563180-166563202 TGGTGGCTTTTCCGGGGTAGTGG + Intronic
1019090634 6:169529300-169529322 TGGTGACCTCTGCGGGGGGGGGG + Intronic
1021306101 7:19034400-19034422 TGGTGCCTGCAGCGGGGTTGTGG - Intronic
1021996136 7:26179780-26179802 TGCTGATTTCTCTGGGGTTGAGG + Intronic
1023162717 7:37312800-37312822 TGGTGATTTACCCTGGGTTGTGG - Intronic
1028832874 7:95345442-95345464 TGGTGCCTACTCTGGGGGTGGGG + Intergenic
1030744960 7:113153887-113153909 TTGTGCCTTCTCCTGAGTTGAGG + Intergenic
1031098567 7:117449398-117449420 TGGTGAGTTCTCCCAGGCTGTGG - Intergenic
1034326334 7:150237390-150237412 TGGTGAGTTCTCTAGGGCTGTGG - Intergenic
1034766877 7:153731866-153731888 TGGTGAGTTCTCTAGGGCTGTGG + Intergenic
1035271363 7:157722029-157722051 TGGTGGCTGCTCCGGGGGTGGGG - Intronic
1037617854 8:20535678-20535700 TGGTGAATTCTCCAAAGTTGTGG + Intergenic
1037652817 8:20854775-20854797 TGGTGACTTGTCCAGGAATGGGG + Intergenic
1039892272 8:41693770-41693792 TGTTGACTTCCCCGGGAGTGAGG - Intronic
1041280954 8:56211100-56211122 CGGTGAGTTCTCCGGGGGTCCGG - Exonic
1042331691 8:67587321-67587343 GGGGGACTTCTAAGGGGTTGAGG + Intronic
1046813171 8:118554521-118554543 TGGGGACTGCTGTGGGGTTGGGG + Intronic
1047756087 8:127919537-127919559 TGGTGACTGCTCAGGGGAGGGGG - Intergenic
1049803763 8:144529901-144529923 TGGTGACTGCTCAGGAGTTTGGG - Exonic
1050554488 9:6777439-6777461 TGGGCACATCTCCGGGGCTGTGG + Intronic
1051288918 9:15525925-15525947 TGGTGACTTCCCAGGAGTGGGGG - Intergenic
1056969591 9:91191239-91191261 GAGTGATTTCTCCTGGGTTGGGG - Intergenic
1057819671 9:98321441-98321463 TGATGACTTCTGCCAGGTTGGGG - Intronic
1058656708 9:107228917-107228939 TGTTGACTCCTCGGGGGATGGGG + Intergenic
1059442007 9:114313222-114313244 TGGTGATTTTCCAGGGGTTGGGG - Intergenic
1059744343 9:117185583-117185605 TGGTGACGTCTCCTGGTGTGGGG + Intronic
1187281250 X:17860313-17860335 CGGTGGCTTTTTCGGGGTTGGGG - Intronic
1196198063 X:112855995-112856017 TGGTGACTTCCCAGGAGTTGGGG + Intergenic
1199953208 X:152721953-152721975 TGGTGACCTCTGCGGGGGGGCGG - Intergenic
1199956474 X:152746493-152746515 TGGTGACCTCTGCGGGGGGGCGG + Intergenic
1200247401 X:154533460-154533482 TGGTGACTTCTCCGGGGTTGAGG + Intronic
1201746437 Y:17379504-17379526 TGGTGACTCCTCCGAGGTCTGGG - Intergenic