ID: 1200247410

View in Genome Browser
Species Human (GRCh38)
Location X:154533520-154533542
Sequence GTCACAGATGGGCCTGCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200247404_1200247410 -6 Left 1200247404 X:154533503-154533525 CCCCAGCTCAGTGCCTCGTCACA 0: 1
1: 0
2: 2
3: 8
4: 194
Right 1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1200247402_1200247410 26 Left 1200247402 X:154533471-154533493 CCGGGGTTGAGGACACCTGCTCT 0: 1
1: 1
2: 11
3: 84
4: 450
Right 1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1200247406_1200247410 -8 Left 1200247406 X:154533505-154533527 CCAGCTCAGTGCCTCGTCACAGA 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1200247403_1200247410 11 Left 1200247403 X:154533486-154533508 CCTGCTCTGCATGCACACCCCAG 0: 1
1: 0
2: 0
3: 28
4: 271
Right 1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1200247405_1200247410 -7 Left 1200247405 X:154533504-154533526 CCCAGCTCAGTGCCTCGTCACAG 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200247410 Original CRISPR GTCACAGATGGGCCTGCGAC AGG Intronic
902871418 1:19315780-19315802 GTGACAGATGGACCTGAGGCGGG + Intronic
903941441 1:26934570-26934592 GTCACAGATGAGCTTTGGACTGG - Intronic
911669503 1:100592234-100592256 GGCACAGAATGGCCTGCCACAGG - Intergenic
911791480 1:102021202-102021224 GTCATAGCAGGGCCTGGGACAGG - Intergenic
913183620 1:116346212-116346234 ATCACAGATGGCCCTGGGACAGG + Intergenic
914388726 1:147198552-147198574 GTGAAAGATGGGCCTGAGGCCGG + Intronic
922737896 1:227999204-227999226 TTCACACATGGGCCTGGGCCTGG - Intergenic
923306361 1:232692475-232692497 GTCACATATGTCCCTGCAACTGG - Intergenic
1072611008 10:97017706-97017728 GACACAGCTGGGGCTGCCACTGG - Intronic
1075996330 10:126879079-126879101 GTCTCAGATGGGTCTGCGTGGGG - Intergenic
1077343862 11:2037565-2037587 GGCACAGAGGGGCCGGAGACAGG + Intergenic
1082202569 11:49390517-49390539 GGCACAGAAGGGGCTGTGACTGG - Intergenic
1084334314 11:68447757-68447779 GTCACAGAGGGGCCTGCAATGGG - Intronic
1084959304 11:72707931-72707953 GTCACATTTGGGGCTGGGACAGG - Intronic
1085125325 11:73997963-73997985 GTCACAAATGGGACTGAGTCAGG + Intergenic
1085666152 11:78417460-78417482 GTCACAGGTGGGCCGCCGAGGGG - Intronic
1086035131 11:82405559-82405581 CTCACAGTGGGGCCTGGGACAGG - Intergenic
1086652463 11:89309571-89309593 GGCACAGAAGGGGCTGTGACTGG + Intergenic
1088808817 11:113375590-113375612 GTCAGAGATGGTCATGTGACCGG + Intronic
1089460959 11:118653235-118653257 GTCAGAAATGGGCCTGTGGCTGG + Intronic
1202826848 11_KI270721v1_random:92754-92776 GGCACAGAGGGGCCGGAGACAGG + Intergenic
1093452991 12:19336899-19336921 GACACAGATGGACCTGTGAAAGG - Intronic
1102740933 12:115206979-115207001 GTCAGGGTTGGGCCTGGGACAGG + Intergenic
1102964458 12:117115093-117115115 GGCAGAGATGGGCAAGCGACAGG - Intergenic
1107986312 13:45779557-45779579 GGCAGAGCTGGGCCTGGGACCGG - Exonic
1118755813 14:68843253-68843275 GTCACAGATGAGGCTGGGAGGGG - Intergenic
1119788983 14:77332272-77332294 GTCACAGATGGTGCTGGGAATGG + Intergenic
1122155110 14:99746203-99746225 GAGACAGATGGGACTGAGACAGG + Intronic
1122313098 14:100809704-100809726 GTCACAGGTGGGTTTTCGACGGG - Intergenic
1128790702 15:70431749-70431771 GTCACGGATGGGCCTGCAGGAGG + Intergenic
1131396693 15:92092008-92092030 GGCCCAGATGGGCCAGTGACTGG - Intronic
1132684899 16:1158233-1158255 GACACAGATGGGGCTGAGACTGG + Intronic
1136453768 16:30369516-30369538 GTCCCAGAGGGGCCTGTGCCAGG + Exonic
1137685325 16:50382701-50382723 TTCAGAGGTGGGCCTGTGACTGG + Intergenic
1139636229 16:68260125-68260147 GCCACAGATAGGCCTGCCACTGG + Exonic
1142245260 16:88967443-88967465 TTCACAGATGTGCCGGAGACGGG + Intronic
1143463990 17:7123412-7123434 GACATAGATGGGCCGGAGACTGG + Intergenic
1144689688 17:17252517-17252539 TTCACAGATGGGGGTGCTACTGG - Intronic
1147268016 17:39246591-39246613 GTGACAGATGGGCCTGGGCCAGG - Intergenic
1149784572 17:59424206-59424228 GGCACAGATGGGCATGTGCCAGG - Intergenic
1149867032 17:60156801-60156823 AGCACAGATGGGCCTGGGTCTGG - Intronic
1151225986 17:72648752-72648774 GTCCCAGCTGGGACTGGGACAGG + Intronic
1151443502 17:74148674-74148696 GTCAAAGATGGGCCACCCACAGG + Intergenic
1152097031 17:78278393-78278415 GGCACAGCTGGGCCTGTGAGGGG + Intergenic
1152782001 17:82230818-82230840 TTCACAGATGGGCCTGACTCGGG - Intronic
1160922123 19:1525945-1525967 GTCACAGGTGAGTCTGAGACGGG - Intronic
1162028824 19:7908809-7908831 GCCAGAGAGGGGCCTGGGACAGG - Intronic
1162228416 19:9244012-9244034 GTCACTGATGGGTCTGATACTGG - Intergenic
1163235772 19:16029610-16029632 GCCACAGAGGAGCCTGGGACAGG + Intergenic
1164039600 19:21483358-21483380 GACACACATGGGCCCGCAACCGG - Intronic
1164785337 19:30926126-30926148 GTCACAGATGTGTGTGTGACAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926045080 2:9704190-9704212 GTCACACATGAGCCTGCTACTGG - Intergenic
926104550 2:10142127-10142149 CTCACAGACGCGCCTGCCACAGG - Intronic
933165738 2:79072602-79072624 CTCACAGATGGTCCTGCTCCAGG - Intergenic
934662401 2:96150176-96150198 TTCCCAGATGGGCCTGGGCCTGG + Intergenic
940021540 2:149161160-149161182 GTGACAGATGGGGGTGCGTCGGG + Intronic
946313230 2:218894432-218894454 GTCAGAGATGGGGCTTGGACTGG + Intronic
1172177696 20:32982593-32982615 ATCAGAGATGGGCCTGGGTCAGG + Intergenic
1172177729 20:32982727-32982749 ATCAGAGATGGGCCTGGGCCAGG + Intergenic
1173148603 20:40546700-40546722 GTCTCAGATGAGCCTGCATCGGG - Intergenic
1175173149 20:57093635-57093657 GTCACAGATGGCCATGAGCCTGG + Intergenic
1175705110 20:61171001-61171023 GACACAGGTGGGCCTGAGACAGG + Intergenic
1181791786 22:25273254-25273276 TTCAGAGATGGGCATGTGACTGG + Intergenic
1181827422 22:25529059-25529081 TTCAGAGATGGGCATGTGACTGG + Intergenic
949882924 3:8675729-8675751 GTCACAAAGGGGGCTGGGACCGG + Intronic
950187413 3:10953651-10953673 GTCACCCATGGGGCTGAGACAGG + Intergenic
950577252 3:13839572-13839594 GTCACAGATGGACCAGCTCCTGG - Intronic
952855235 3:37764761-37764783 TTCACAGATGGCCCTGCCTCAGG + Intronic
954395851 3:50292922-50292944 GTCACAGATGGGCCGTGCACGGG - Exonic
955604889 3:60690739-60690761 TTCACAGATGGTGCTGCCACTGG - Intronic
956174480 3:66460105-66460127 GACACAGATAGGGCTGGGACTGG - Intronic
977765534 4:100793225-100793247 GTCAGCGATGGGCCTGGGGCTGG - Intronic
979529287 4:121751683-121751705 GTTAAAGATGGGCCTGCACCTGG - Intergenic
985837706 5:2282601-2282623 GTGACAGGTGGGCCTGCAGCAGG + Intergenic
985861773 5:2477159-2477181 GTCACCCATGTGCCTGAGACAGG - Intergenic
993151954 5:84173351-84173373 GTCACAGCTCGTCCTGCAACTGG - Intronic
999149581 5:149417850-149417872 GTCCCAGCTGGACCTGTGACTGG + Intergenic
1005355322 6:24977652-24977674 ATCACTGATGGGCCAGTGACGGG - Intronic
1006401644 6:33821227-33821249 GACACAGATGCCCCTGCAACTGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023501959 7:40860306-40860328 CTCACAGCTGGGCCTGCCAAAGG - Exonic
1024524006 7:50332703-50332725 GGCCCATATGGGCCTGGGACAGG + Intronic
1025118416 7:56278439-56278461 GCCACATATGGGCCTGCTAAAGG + Intergenic
1029696500 7:102217153-102217175 GACACAGATGGCCCTGCTTCAGG - Intronic
1032444763 7:131972714-131972736 GTAACTGATGGGGCTGAGACTGG - Intergenic
1036833463 8:12039642-12039664 GTCACAAATGGGGCGGGGACCGG - Intergenic
1036855309 8:12286207-12286229 GTCACAAATGGGGCGGGGACCGG - Intergenic
1038646516 8:29366352-29366374 ATCACAGATGGCTCTGGGACAGG - Intergenic
1040328373 8:46373795-46373817 GTCACAGATGGGCCTGTGTGGGG - Intergenic
1044529202 8:93289081-93289103 GGTACTGATGGGCCTGCGGCTGG - Intergenic
1047518211 8:125573724-125573746 GTCAGAGGTGAGCCTGTGACAGG - Intergenic
1049574947 8:143385645-143385667 GTCACAGATGGGCCGAGGGCAGG + Intergenic
1049616939 8:143579654-143579676 GGCAGAGATGGGGCTGAGACAGG + Intergenic
1056774218 9:89499191-89499213 GTGACTGTTGGGCCTGGGACTGG - Intergenic
1061849192 9:133404680-133404702 CTCACACAGGGGCCTGGGACAGG - Intronic
1062020043 9:134315066-134315088 TTCACAGAAGGCCCTGCTACTGG + Intergenic
1186514775 X:10158740-10158762 GTCACGCGTGGGCCTGCCACGGG - Intronic
1187432790 X:19240079-19240101 GGCACAGATGGGGCAGCAACAGG - Intergenic
1190248910 X:48707757-48707779 CCCACAGATGGGGCTGGGACAGG - Exonic
1200063937 X:153495953-153495975 GTCCCAGAGGGGCCTGCCAAGGG + Intronic
1200151510 X:153953608-153953630 GGCACAGAGGGGCCCGGGACCGG + Exonic
1200247410 X:154533520-154533542 GTCACAGATGGGCCTGCGACAGG + Intronic