ID: 1200248653

View in Genome Browser
Species Human (GRCh38)
Location X:154540552-154540574
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200248645_1200248653 17 Left 1200248645 X:154540512-154540534 CCTGGAATCCCAGCTACTCAGGA 0: 200
1: 55356
2: 144217
3: 231484
4: 202486
Right 1200248653 X:154540552-154540574 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1200248647_1200248653 9 Left 1200248647 X:154540520-154540542 CCCAGCTACTCAGGAGGCTAAGG 0: 3769
1: 105626
2: 210490
3: 240684
4: 150489
Right 1200248653 X:154540552-154540574 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1200248649_1200248653 8 Left 1200248649 X:154540521-154540543 CCAGCTACTCAGGAGGCTAAGGC 0: 2931
1: 92302
2: 198207
3: 231078
4: 156316
Right 1200248653 X:154540552-154540574 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200248653 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intronic
Too many off-targets to display for this crispr