ID: 1200249211

View in Genome Browser
Species Human (GRCh38)
Location X:154543312-154543334
Sequence GCCTGTGGCCAGCTTCGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200249211_1200249219 26 Left 1200249211 X:154543312-154543334 CCAACCCGAAGCTGGCCACAGGC No data
Right 1200249219 X:154543361-154543383 TTGGAAAAGCCTAAGGACCCTGG No data
1200249211_1200249220 27 Left 1200249211 X:154543312-154543334 CCAACCCGAAGCTGGCCACAGGC No data
Right 1200249220 X:154543362-154543384 TGGAAAAGCCTAAGGACCCTGGG No data
1200249211_1200249218 19 Left 1200249211 X:154543312-154543334 CCAACCCGAAGCTGGCCACAGGC No data
Right 1200249218 X:154543354-154543376 AATCAGCTTGGAAAAGCCTAAGG No data
1200249211_1200249217 7 Left 1200249211 X:154543312-154543334 CCAACCCGAAGCTGGCCACAGGC No data
Right 1200249217 X:154543342-154543364 GTGAAATGACAAAATCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200249211 Original CRISPR GCCTGTGGCCAGCTTCGGGT TGG (reversed) Intronic