ID: 1200249524

View in Genome Browser
Species Human (GRCh38)
Location X:154545448-154545470
Sequence ATGGACTTCTTGGGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200249524_1200249533 18 Left 1200249524 X:154545448-154545470 CCTGTTTTCCCCAAGAAGTCCAT 0: 1
1: 0
2: 3
3: 40
4: 207
Right 1200249533 X:154545489-154545511 GCCTGCAACTCCAGGATTAAGGG 0: 1
1: 0
2: 0
3: 21
4: 314
1200249524_1200249532 17 Left 1200249524 X:154545448-154545470 CCTGTTTTCCCCAAGAAGTCCAT 0: 1
1: 0
2: 3
3: 40
4: 207
Right 1200249532 X:154545488-154545510 AGCCTGCAACTCCAGGATTAAGG 0: 1
1: 0
2: 0
3: 33
4: 541
1200249524_1200249531 10 Left 1200249524 X:154545448-154545470 CCTGTTTTCCCCAAGAAGTCCAT 0: 1
1: 0
2: 3
3: 40
4: 207
Right 1200249531 X:154545481-154545503 CCTAAAGAGCCTGCAACTCCAGG 0: 1
1: 1
2: 0
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200249524 Original CRISPR ATGGACTTCTTGGGGAAAAC AGG (reversed) Intronic
900196271 1:1377284-1377306 ATGGGTATTTTGGGGAAAACAGG - Intergenic
902934692 1:19756438-19756460 ATGGAATTCCTGGGGCAAAGGGG - Intronic
904672060 1:32173425-32173447 TTGGAGTTCTTAGGGAAAACTGG - Exonic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
906371857 1:45260710-45260732 ATGGACTTTGGGGGGAAAACTGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908739870 1:67316565-67316587 ATGGACTTGTTTGCGAAAAAAGG - Intronic
909101279 1:71352390-71352412 AGGGACAGCATGGGGAAAACTGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909881265 1:80881849-80881871 ATGGCCTACTGGGGGAGAACAGG - Intergenic
912158047 1:106946653-106946675 ATGGACTTCCTGGAGCAAAGAGG - Intergenic
912247800 1:107978917-107978939 CTGGACTTGGTGGGGAAAAGAGG + Intergenic
914587082 1:149072565-149072587 AAGGACTTCTTGGGTAAGAACGG - Intronic
915037857 1:152943684-152943706 ATGATCTTCTTGGGGAAATAAGG - Intergenic
915502693 1:156330244-156330266 ATGGACTTTTAGGGAAAACCTGG - Intronic
915772616 1:158444481-158444503 ATGGAATTCTCAGGGCAAACGGG - Intergenic
917113924 1:171582279-171582301 ATCCACTTCTTAGGGAGAACAGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917771676 1:178286367-178286389 TTGGACATTTTAGGGAAAACAGG - Intronic
919966614 1:202533169-202533191 ATGGACTTCATTAGGACAACTGG - Intronic
920742033 1:208590114-208590136 AAGGACTTCTGGAAGAAAACAGG - Intergenic
921532624 1:216304209-216304231 ATGTATTCCTTGTGGAAAACAGG - Intronic
922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1062785291 10:259858-259880 ATGGAGTTTTAGAGGAAAACAGG + Intergenic
1063050407 10:2441118-2441140 ATGGGATCCTTGGAGAAAACTGG + Intergenic
1063340474 10:5258551-5258573 AAGGACATTTTGGGGAAGACTGG - Intergenic
1063536790 10:6891320-6891342 TTTGGCTTCTTGGGGAAGACTGG + Intergenic
1064177503 10:13087600-13087622 ATGGAAGTCTGGGGAAAAACAGG + Intronic
1065173814 10:23057639-23057661 ATGTACTTTTTAGGTAAAACAGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1070593553 10:77817385-77817407 ATGGAGATCTTGGGGAACTCTGG - Intronic
1071229548 10:83569424-83569446 ATGGACTTTCTGGGGAAATAAGG + Intergenic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1073217884 10:101846632-101846654 ATTGACTTCTCTGGGAAAACTGG - Exonic
1073407735 10:103312562-103312584 ATATAATTCTTGGGGAAAAAAGG - Intronic
1073531615 10:104237765-104237787 ATGGGCTTCTTGCTGAAGACAGG - Intronic
1074862817 10:117525152-117525174 CTGGATCTCTTGGGTAAAACTGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1079933100 11:26589591-26589613 AGGGACTTTTGGGGGAAAATAGG - Intronic
1080218731 11:29875861-29875883 AGGGAGTTCTAGGGGAACACTGG - Intergenic
1080394502 11:31877304-31877326 CGGGACTTCTGGGGGTAAACTGG - Intronic
1080399108 11:31917653-31917675 ATGGGCATCTTTGGGAATACAGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084898209 11:72291234-72291256 AAGGACATCATCGGGAAAACTGG + Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1087816888 11:102668390-102668412 ATGTAATCATTGGGGAAAACTGG - Intergenic
1091869843 12:3880155-3880177 ATTCACATCTTGGGGAAAACGGG + Intergenic
1093535682 12:20219918-20219940 TTGGTCTTCTGGGGGAAAAGGGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1095118787 12:38387859-38387881 ATGGACATCTTGGGGGAAGGTGG - Intergenic
1095296086 12:40529283-40529305 ATGGATTTCTTAGGGAAAATGGG + Intronic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095467559 12:42503931-42503953 AGGGAATTCTTGGGGAAAAGTGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097626246 12:62003899-62003921 ATGCACTTCTTGTGAAAAATGGG - Intronic
1098320155 12:69235152-69235174 ATTGACTTATTGGCGTAAACTGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101196855 12:102392454-102392476 ATGGACATGTAGGGGATAACAGG - Intergenic
1103441480 12:120966100-120966122 ATTGGCTTCTTTGGGAAAAGTGG - Intergenic
1104448651 12:128852936-128852958 ATGGGCTTCATTGGGAAATCAGG - Intergenic
1105812185 13:24005525-24005547 ATGGAATCCTTGGTGAAAAAGGG + Intronic
1106220744 13:27744446-27744468 TTGGACTTGTTGGGGAGTACAGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107792466 13:44016028-44016050 ATGGACTTCCTATTGAAAACTGG + Intergenic
1108014977 13:46065293-46065315 ATTGGGTTCTTGGGGTAAACTGG + Intronic
1108927640 13:55772446-55772468 TTGGATTTTTTGGGGAAAATAGG + Intergenic
1110261881 13:73494077-73494099 ATTGACTACTTGGTGAAAATTGG - Intergenic
1110268627 13:73568283-73568305 ATGGGCCTCTTGGGCAACACTGG - Intergenic
1112603039 13:100875769-100875791 TTGAACTTCTTGGGCAAACCAGG - Intergenic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117064397 14:51995561-51995583 ATGGACATCTTGGGGGGTACAGG + Intronic
1118017382 14:61673951-61673973 ATGGAATTTTAGGGGAAAATAGG - Intergenic
1121872860 14:97425575-97425597 GTGGACTTCTTGAGGAAAAGGGG - Intergenic
1124654139 15:31495024-31495046 ATGGACGTCTTGGGGAGGTCTGG + Intronic
1127360755 15:58243047-58243069 ATGGCCTTGATGGGGAAGACAGG + Intronic
1130090281 15:80815074-80815096 ATTCACTTCTTTGGAAAAACCGG + Intronic
1130806235 15:87326505-87326527 AGGGAATTCTGGGGGAAAAAAGG + Intergenic
1141738218 16:85870063-85870085 ATCTATTTCTTGGGAAAAACAGG - Intergenic
1143950070 17:10625298-10625320 ATGTCCTTATGGGGGAAAACTGG - Intergenic
1144044121 17:11439486-11439508 TTAGACTTCTGGGGGAAAAATGG + Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1146456484 17:33013426-33013448 ATGGGCAGCTTGGGGAAAAGGGG + Exonic
1147447680 17:40484706-40484728 AAGGACTTCCTGGGGACAAAAGG - Intronic
1147767840 17:42849004-42849026 GTGGACATCATGGGGAAGACAGG + Intronic
1153182256 18:2447818-2447840 ATGGACTGAGTGGGGAAACCAGG + Intergenic
1157325325 18:46664686-46664708 AAGGATTTCATGGAGAAAACTGG - Intergenic
1159683929 18:71392760-71392782 ATGGTATTCTTGGGGCAAATGGG + Intergenic
1160575051 18:79848569-79848591 ACGGACTTCATGGGGAAACAGGG - Intergenic
1161497154 19:4592923-4592945 TTGAGTTTCTTGGGGAAAACTGG + Intergenic
1162696279 19:12478656-12478678 ATTGAGGTCTTGGGGAAAGCAGG + Intronic
1166314816 19:41983519-41983541 ATGGACTTCTGGGGTGAAGCTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926003754 2:9355183-9355205 AAGGACATTTGGGGGAAAACTGG - Intronic
926709467 2:15866398-15866420 ATAGACTACTTGGAGAAACCAGG - Intergenic
929105641 2:38362920-38362942 ATGGACATCTGGAGGAAAAGAGG + Intronic
930297417 2:49572291-49572313 AAGCTCTTCTTGGGGAAAACTGG - Intergenic
930536793 2:52653674-52653696 AAGGTCTTCTTGGGGAAGAATGG + Intergenic
930694495 2:54397428-54397450 ATGGATGTCTTGGGGAGAGCAGG - Intergenic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
932524732 2:72452532-72452554 AAAGACCTCATGGGGAAAACAGG + Intronic
933285301 2:80378822-80378844 ATAGCCTTCTTGGGGAAAGCTGG - Intronic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934612722 2:95752974-95752996 ATGGACTTTTGGGGGAATAAGGG - Intergenic
934648192 2:96071449-96071471 ATGGACTTCTAGGGGAATGAGGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
936608758 2:113981227-113981249 AAGGACTTCATGGGGAAAGGAGG - Intergenic
937294589 2:120802157-120802179 ATGGACTCCTAGGGGAAGTCAGG - Intronic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
943919693 2:193689336-193689358 ATAGACTTCCAGGGAAAAACTGG - Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1170531892 20:17301555-17301577 ATAGTCTTCTTGGAGAAAATGGG + Intronic
1171251444 20:23652093-23652115 ATGGATATCTTGGGGATAACTGG - Intergenic
1171801144 20:29619143-29619165 ATAGACTTCTCAGGGAAACCTGG + Intergenic
1172918022 20:38458605-38458627 ATGGACATCAATGGGAAAACTGG - Intergenic
1174105455 20:48159154-48159176 ATATTCTGCTTGGGGAAAACAGG + Intergenic
1175503422 20:59466181-59466203 ATGGCCTTCATGGGGAAGACAGG - Intergenic
1175570217 20:60012513-60012535 ATGGAGTTTCTGGGGAAAAGTGG - Exonic
1178417621 21:32416653-32416675 TTGAACTTCTTGGAGAAAAAAGG - Intronic
1179173498 21:38991019-38991041 ATGCACCTGTTGGGGAAAGCTGG + Intergenic
1179721222 21:43316917-43316939 ATGACCTTCTTTGGGAAAATGGG + Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
1185267440 22:49911861-49911883 ATGGACCTGATGGGGAAAAGGGG - Intronic
1185417121 22:50716336-50716358 GGTGACTTTTTGGGGAAAACTGG - Intergenic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949547407 3:5083742-5083764 AGGGACTTCTTTGGGAAGTCTGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951223345 3:20092998-20093020 ATGGACTTTATGTGAAAAACTGG - Intronic
951329130 3:21344165-21344187 CTGGACTTTTTGGCGAACACTGG + Intergenic
952493658 3:33896862-33896884 TTGGACTTCATGGGCAGAACTGG - Intergenic
952852971 3:37744272-37744294 GAGGGCTTCTTGGGGAAAACTGG - Intronic
953218115 3:40940220-40940242 ATGTAACTCTTGGGGAAAATAGG - Intergenic
953935785 3:47040971-47040993 GTGGAATTGTTGGGCAAAACAGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961924324 3:130461108-130461130 GTGGACTTTTTGGGGAAATCAGG + Intronic
962124528 3:132601857-132601879 ATGGAACCATTGGGGAAAACTGG + Exonic
962625193 3:137219199-137219221 ATGGAATTCTTAGGGGCAACTGG + Intergenic
962840582 3:139228889-139228911 ATGGACTTCTGGGACAATACAGG - Intronic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
963102282 3:141619081-141619103 ATGGAGTTTTTGGGGAAGGCTGG - Intergenic
964320779 3:155494770-155494792 ATTGAATTCTTAGGGAGAACAGG - Intronic
964327723 3:155565235-155565257 ATGGCATTTGTGGGGAAAACTGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966327746 3:178776133-178776155 ATGGAGTTGTTGGGGAAGGCAGG - Intronic
966854534 3:184185170-184185192 AGTGACTTCATGGGGACAACAGG - Intronic
967632541 3:191762464-191762486 ATTGACTTCCTGTAGAAAACTGG + Intergenic
967820830 3:193837282-193837304 AAGAACTTATTGGGGAAAATAGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
970730104 4:19092455-19092477 AAGGAGTTATTGTGGAAAACTGG - Intergenic
972453435 4:39228256-39228278 AAGGTGTTCTTTGGGAAAACTGG + Exonic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
976629533 4:87222288-87222310 AAGGACTTTTAGGGGAAAATGGG - Intronic
976881322 4:89928891-89928913 ATGGACACCTTGGGGGAAAGGGG + Intronic
977886442 4:102257468-102257490 AAGGCCTTCTTGGGCAAAACAGG + Intronic
978481088 4:109191551-109191573 ATGCACTCCTTATGGAAAACAGG - Intronic
979856809 4:125643472-125643494 AGGGACTTCAGGGAGAAAACTGG - Intergenic
980693680 4:136328882-136328904 AGGTACTTCTTGGGGAAACACGG - Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
985023760 4:185718694-185718716 ATGCACTTCTTTGGGAGAGCTGG + Intronic
987780812 5:22432695-22432717 TTAGACTTTGTGGGGAAAACAGG - Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991336503 5:65553975-65553997 AAGGACTTCTGGGGTAAGACTGG - Intronic
991456142 5:66806804-66806826 ACTGGCATCTTGGGGAAAACAGG - Intronic
992099243 5:73390317-73390339 AGAGACTTCTTTGGGAAATCTGG + Intergenic
993913306 5:93710310-93710332 TTTAACTTCTTTGGGAAAACCGG + Intronic
994335158 5:98556218-98556240 TTGGACTTCTTGGGGACATACGG + Intergenic
996975269 5:129425565-129425587 ATGGAGGTCTTGGGCACAACAGG - Intergenic
997798889 5:136840081-136840103 ATGGAGCTTGTGGGGAAAACTGG + Intergenic
998872353 5:146565269-146565291 AAGAACTTCTTGGGGAAACTAGG + Intergenic
1000137476 5:158366707-158366729 ATGTACTGATTGGGGAAAATAGG + Intergenic
1002442181 5:179270230-179270252 GTGGGCTTCTCGGGGAAAACAGG + Intronic
1005431629 6:25763837-25763859 ATGGACTTCTGGGGGAAAAGGGG - Intronic
1007982472 6:46172819-46172841 ATGGACTTCTGGGAGGAATCTGG - Intergenic
1008818652 6:55603630-55603652 AAGGTCTTCTTGGGGAAAACTGG + Intergenic
1010409400 6:75543986-75544008 ATGGACCTCTTGGGGAGAAAGGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1012415033 6:99004058-99004080 ATGCACCTCTTGAGGAAATCAGG - Intergenic
1014679960 6:124416162-124416184 ATGCAATTCTTTGGGAATACAGG - Intronic
1015007817 6:128305352-128305374 ATGGACTCTTTGTGGAAAAAAGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015979437 6:138824206-138824228 ATGGAACCATTGGGGAAAACTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1021785067 7:24143230-24143252 ATTGCCTTCTTGGGGAACCCTGG - Intergenic
1023069641 7:36416692-36416714 ATGCACACCTTGGGGGAAACTGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027486386 7:78766793-78766815 ATGCACTTCTTCTGGAAAGCAGG + Intronic
1028028274 7:85874949-85874971 ATGGTTTTCTTGGGGGAAAATGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1032438539 7:131922429-131922451 GCCGACTTCTTAGGGAAAACAGG + Intergenic
1032705126 7:134414777-134414799 ATGATCGTCTTGGGGAAAAAAGG + Intergenic
1033641117 7:143263879-143263901 ATGGCAGTTTTGGGGAAAACTGG + Intronic
1037775434 8:21832599-21832621 AGGGGCTTTTTGGGGAAAATGGG - Intergenic
1041444660 8:57937513-57937535 GTTGACCTCTTGGGGAAAAATGG + Intergenic
1041778131 8:61546734-61546756 TTGGTCTACTTGGGGAAAAGAGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045558335 8:103236648-103236670 ATGAACTTGTTAAGGAAAACTGG - Intergenic
1048980416 8:139700831-139700853 ATGCATTTCTTAAGGAAAACTGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052105510 9:24510108-24510130 AGAGACTTATTGGGGAAAATTGG + Intergenic
1052613210 9:30802493-30802515 ATGGAATTCATGAGGAAGACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055002446 9:71467397-71467419 ATGTAACTCTTGGGGAAAACTGG - Intergenic
1055960338 9:81814551-81814573 ATGCTCTTCTGGGAGAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056062684 9:82900297-82900319 ATGGACTTCTTGTGGCAAGTGGG + Intergenic
1057438395 9:95063365-95063387 ATGGACTTCCTGGGGGAAAGAGG - Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058581040 9:106457648-106457670 ATTGTCTTTTTGGGGAAGACAGG + Intergenic
1059633384 9:116149263-116149285 ATGGATTTCTTGGGGTTATCTGG - Intergenic
1060113189 9:120921039-120921061 ATGGACTTCTGGTGAAAAGCTGG - Intronic
1187049591 X:15682689-15682711 ATATTCTCCTTGGGGAAAACAGG - Intergenic
1188482490 X:30649794-30649816 AAGCACTTCTGGGGGAAAAGGGG + Intergenic
1189461301 X:41245094-41245116 AGGGACTTCACAGGGAAAACTGG + Intergenic
1191226549 X:58050261-58050283 GAGGTCTTCTTGGGGAAAAATGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191724819 X:64268586-64268608 ATGGGCATCTTGGGGGACACAGG - Exonic
1194809637 X:98374898-98374920 ATGGATTTATTGGGCAAAAAGGG + Intergenic
1195962225 X:110397797-110397819 ATGGACTTGGGGGGGCAAACAGG + Intronic
1196321426 X:114344886-114344908 ATGGGTTTCTTGAGAAAAACAGG + Intergenic
1196996747 X:121391644-121391666 GTGGACTTCTTGCTGAAAAATGG + Intergenic
1197901254 X:131375325-131375347 ATGAACTTCTTCTGGAAAAATGG + Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1201506022 Y:14701281-14701303 ATGGCCCTCTTTGGGACAACTGG + Intronic
1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG + Intergenic