ID: 1200249947

View in Genome Browser
Species Human (GRCh38)
Location X:154547395-154547417
Sequence CGCCGCCGTCCGAGAGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200249937_1200249947 18 Left 1200249937 X:154547354-154547376 CCCCCGGAGAGGGCGGGGCGGCC 0: 1
1: 0
2: 2
3: 23
4: 204
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1200249943_1200249947 -10 Left 1200249943 X:154547382-154547404 CCCCGAGGCTAGACGCCGCCGTC 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1200249935_1200249947 21 Left 1200249935 X:154547351-154547373 CCTCCCCCGGAGAGGGCGGGGCG 0: 1
1: 0
2: 4
3: 24
4: 208
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1200249940_1200249947 15 Left 1200249940 X:154547357-154547379 CCGGAGAGGGCGGGGCGGCCGAG 0: 1
1: 0
2: 2
3: 34
4: 483
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1200249939_1200249947 16 Left 1200249939 X:154547356-154547378 CCCGGAGAGGGCGGGGCGGCCGA 0: 1
1: 0
2: 2
3: 21
4: 239
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1200249942_1200249947 -3 Left 1200249942 X:154547375-154547397 CCGAGCGCCCCGAGGCTAGACGC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20
1200249938_1200249947 17 Left 1200249938 X:154547355-154547377 CCCCGGAGAGGGCGGGGCGGCCG 0: 1
1: 0
2: 3
3: 42
4: 332
Right 1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200249947 Original CRISPR CGCCGCCGTCCGAGAGACGA GGG Intronic
902304725 1:15527093-15527115 CGCCGCCCTCCGAGAGCCCAGGG - Intronic
902434963 1:16392566-16392588 CGCCGCTGTCCAAAAGACCAGGG + Intronic
907491910 1:54813998-54814020 AGCTGCCCTCCGAGAGAGGAAGG - Intronic
1089347110 11:117797408-117797430 CTCCGCTGTCTGAGAGGCGAGGG + Intronic
1124900553 15:33818746-33818768 CACTGCCGTCTGAGAGAAGAAGG - Intronic
1137676896 16:50308314-50308336 TGCCGCCGTCCTGGAGAGGAGGG - Exonic
1146187734 17:30736318-30736340 CGCCTCCGTCCGGGAGGTGAGGG - Intergenic
1147425148 17:40342634-40342656 CGCCGCCGGCTGAGTGACGGGGG + Intronic
1149553679 17:57558250-57558272 CGCAGCCATCCGAGGGAAGACGG + Intronic
1175521663 20:59605663-59605685 AGCCGCCGGCAGGGAGACGAAGG + Intronic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
968651959 4:1763716-1763738 GGCCGCCGGCCGAGAGGCGCCGG + Intergenic
996118475 5:119645187-119645209 TGCCGCCATCTGGGAGACGATGG + Intergenic
997470501 5:134114673-134114695 CGCCGCCGGCCGAGTGCCGGGGG - Intergenic
1014272185 6:119348477-119348499 CGCCGCCATCCGCGAGAAAAGGG - Exonic
1029281556 7:99438941-99438963 CGCCGCCGCCCGAGGGATGCCGG - Intronic
1033899433 7:146116854-146116876 CGCCGCCGGCCGGGAGGCGAAGG + Exonic
1034222906 7:149459907-149459929 CGCCGCCGTCCGTGCGAGGGAGG - Intronic
1034228010 7:149497753-149497775 CGCCGCGGCCCGGCAGACGAAGG + Exonic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1057369387 9:94456302-94456324 CTCTGCATTCCGAGAGACGAGGG - Exonic
1061666153 9:132161998-132162020 CGCAGCCGTCCCGGAGACGCGGG - Exonic
1200249947 X:154547395-154547417 CGCCGCCGTCCGAGAGACGAGGG + Intronic