ID: 1200251610

View in Genome Browser
Species Human (GRCh38)
Location X:154557140-154557162
Sequence CAGTCTGTGGTGCTTGGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1818
Summary {0: 4, 1: 2, 2: 40, 3: 352, 4: 1420}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200251610_1200251620 21 Left 1200251610 X:154557140-154557162 CCGTGACCAAGCACCACAGACTG 0: 4
1: 2
2: 40
3: 352
4: 1420
Right 1200251620 X:154557184-154557206 GCGTGGCCTCCCGCTTCTGGAGG 0: 4
1: 0
2: 1
3: 8
4: 113
1200251610_1200251616 4 Left 1200251610 X:154557140-154557162 CCGTGACCAAGCACCACAGACTG 0: 4
1: 2
2: 40
3: 352
4: 1420
Right 1200251616 X:154557167-154557189 GCCGAAGCCACAGAAACGCGTGG 0: 4
1: 0
2: 0
3: 2
4: 42
1200251610_1200251623 29 Left 1200251610 X:154557140-154557162 CCGTGACCAAGCACCACAGACTG 0: 4
1: 2
2: 40
3: 352
4: 1420
Right 1200251623 X:154557192-154557214 TCCCGCTTCTGGAGGCCTGGAGG 0: 4
1: 0
2: 3
3: 15
4: 225
1200251610_1200251621 26 Left 1200251610 X:154557140-154557162 CCGTGACCAAGCACCACAGACTG 0: 4
1: 2
2: 40
3: 352
4: 1420
Right 1200251621 X:154557189-154557211 GCCTCCCGCTTCTGGAGGCCTGG 0: 4
1: 0
2: 2
3: 28
4: 286
1200251610_1200251619 18 Left 1200251610 X:154557140-154557162 CCGTGACCAAGCACCACAGACTG 0: 4
1: 2
2: 40
3: 352
4: 1420
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200251610 Original CRISPR CAGTCTGTGGTGCTTGGTCA CGG (reversed) Intronic
900020788 1:185696-185718 CAGTGCCTGGTGCTGGGTCAGGG - Intergenic
900079404 1:844307-844329 CAGTCTATGGTGCTTTGTTATGG + Intergenic
900585192 1:3429228-3429250 CATTCTGTGGGGCTTGGTTTGGG + Intronic
900691466 1:3983053-3983075 CGGGCTGTGGTGCTTTGCCATGG + Intergenic
900814690 1:4834522-4834544 CAGCCTGGGCTGCTTTGTCACGG + Intergenic
900844546 1:5086244-5086266 CAGACTGTGGTGTTTTGTTATGG + Intergenic
901029632 1:6299470-6299492 CTGTGTGTGGTGCCTGGTAAGGG - Intronic
901029643 1:6299517-6299539 CTGTGTGTGGTGCCTGGTAAGGG - Intronic
901102440 1:6729385-6729407 CAGACTTTGGTACTTGGTTAGGG + Intergenic
901132971 1:6974108-6974130 CAGTGTGTGGAGCTCGGTCTGGG + Intronic
901145201 1:7060163-7060185 CTGTTTGTGGTGCTTTGTTATGG - Intronic
901156597 1:7144063-7144085 CAGTCTGTGGTATTTTGTTACGG - Intronic
901259968 1:7864128-7864150 CTGTCTGTGGTACTTTGTGATGG - Intergenic
901416356 1:9119549-9119571 CAGGCTGTGGTACTTTGTTAGGG + Intronic
901682800 1:10924704-10924726 CAGTCTGTGTTACTTTGTTATGG + Intergenic
901842597 1:11963591-11963613 CAGGCTGTTGGGCTCGGTCAGGG - Exonic
902115144 1:14115046-14115068 CAGTCTGTGGGACTTTGTTATGG - Intergenic
902167648 1:14585210-14585232 TAGTCGGTGGTTCTTGGTTATGG + Intergenic
902437334 1:16406949-16406971 CAGTCTGTGGTCCTTTGTTAAGG + Intronic
902587311 1:17448066-17448088 CTGTCTGTGGTACTTTGTTATGG - Intergenic
902961395 1:19965566-19965588 CAGTCTGTGGGACTTTGTTATGG + Intergenic
903073004 1:20737191-20737213 CTGTCTGTGGTACTTTGTTATGG + Intergenic
903770526 1:25760937-25760959 CAGGCTGTGCTCCATGGTCACGG + Intronic
904668311 1:32141890-32141912 CAGTCTGTGGTTCTTTGTTATGG - Intronic
905272486 1:36796042-36796064 GAGTCAGGCGTGCTTGGTCAGGG + Exonic
905478136 1:38243253-38243275 CAGTTTGTGGTGCTTTGTTAAGG + Intergenic
905523984 1:38622917-38622939 CAGTTTGTGGCGCTTTGTTATGG + Intergenic
906012022 1:42536707-42536729 TAGTCTGTGGTGTTTGGTTATGG - Intronic
906012123 1:42537582-42537604 CAGTCTGTGGTGCTCAATGAAGG - Intronic
906699769 1:47849457-47849479 CAGTCTGTGGTTCTTTGTTACGG + Intronic
906771404 1:48488214-48488236 CAGTTTGTGGTACTTTGTAATGG + Intergenic
907289135 1:53401744-53401766 CAGTCTGTGGTGATTTCTTATGG + Intergenic
907383204 1:54108618-54108640 CAGTCTGTGGTACTTTGTTATGG + Intronic
907442089 1:54485275-54485297 CAGACTGAGGTCCTTGCTCAAGG + Intergenic
907537965 1:55182424-55182446 CAGTCTGTGGTATTTTGTTATGG + Intronic
907788392 1:57636345-57636367 CAGTCTGTGGTATTTTGTTATGG + Intronic
907792136 1:57677266-57677288 CAGTCTATGGTATTTTGTCATGG + Intronic
907830218 1:58057746-58057768 CAGTTTGTGGTACTTTGTCATGG + Intronic
908341041 1:63179421-63179443 CAGTCTGTGATGTTTTGTTATGG + Intergenic
908572324 1:65422495-65422517 CAGTTTGTGGTACTTTGTAACGG + Intronic
908735613 1:67273259-67273281 CAGTCTGTGGTGTTTTGTTATGG - Intergenic
908764374 1:67540717-67540739 CAGTCTGTGGTACTCTGTTATGG + Intergenic
909251076 1:73356925-73356947 CAATGTGTGGTTCTTGGTTAGGG + Intergenic
909471520 1:76034125-76034147 CAGTCTGTGGTATTTGGTTATGG + Intergenic
909538354 1:76763902-76763924 CAGTTTGTGGTGCTTTGTTATGG - Intergenic
909694651 1:78453329-78453351 CAGTCTGTGGTATTTTGTTATGG - Intronic
909704745 1:78568304-78568326 CAGTTTGTGGTGCTTTGTTAAGG + Intergenic
909725218 1:78826788-78826810 CAGTTTGTGGTACTTTGTTATGG - Intergenic
909866725 1:80682657-80682679 CAGCCTGTGGTGCTTTGTTATGG + Intergenic
910157759 1:84239620-84239642 CAGTCTGTGATACTTCATCATGG + Intergenic
910297149 1:85659847-85659869 CAGGCTGGGGTGTGTGGTCAGGG - Intronic
910402225 1:86848544-86848566 CAGTCTGTGATACTTTGTTACGG + Intergenic
910436113 1:87207857-87207879 CAGCCTGTGGTACTTTGTTATGG + Intergenic
910436131 1:87208038-87208060 CAGCCTGTGGTACTTTGTTATGG + Intergenic
910460807 1:87446155-87446177 CAGTCTGTGGTACTTTGTTATGG + Intergenic
910551588 1:88481514-88481536 GAGTCTGTGGTACTTTGTTATGG + Intergenic
910665618 1:89723160-89723182 CAGTTTGTGGTACTTTGTCATGG - Intronic
910726757 1:90348128-90348150 CAGTCTATGGTGCTTGTTATGGG - Intergenic
911293269 1:96083151-96083173 CAGTCTATGGTACTTTGTTATGG + Intergenic
911535430 1:99094172-99094194 CAGTCTGTGGTACTTTGTTATGG + Intergenic
911572069 1:99529317-99529339 CAGTCTGTGGTACTTTGTTATGG - Intergenic
911595027 1:99789856-99789878 CAGTCTGTGTTATTTGGTTATGG - Intergenic
911736689 1:101344029-101344051 CAGTCTGTGGTACTCTGTTATGG + Intergenic
912046782 1:105469050-105469072 CAGTCTGCGGTACTTTGTCATGG + Intergenic
912103844 1:106245536-106245558 CAGTCTGTGGTATTTTGTTATGG + Intergenic
912405106 1:109431110-109431132 CAGTCTGTGGTATTTTGTTATGG + Intergenic
912554335 1:110505291-110505313 CAGTCTGTGGTACTGTGTTATGG + Intergenic
912579900 1:110711103-110711125 CACTCTATGGTGCTTTGTTATGG - Intergenic
912664611 1:111567912-111567934 CAGTCTGTGGTACTTTGTTGTGG + Intronic
912808721 1:112777176-112777198 CAGTTTGTGGTGCTTTGTTATGG - Intergenic
913140764 1:115939133-115939155 CAGTCTGTGGTATTTTGTTATGG + Intergenic
913458643 1:119060196-119060218 CAGTCTATGGTACTTTGTTATGG - Intronic
913461738 1:119093744-119093766 CAGTTTGTGGTACTTGGTTATGG + Intronic
913662724 1:121019080-121019102 CAGTCTGTGGTATTTTGTTATGG - Intergenic
913939996 1:125093331-125093353 CAGTTTGTGTTACTTGGTTATGG - Intergenic
914014105 1:143802342-143802364 CAGTCTGTGGTATTTTGTTATGG - Intergenic
914163716 1:145158854-145158876 CAGTCTGTGGTATTTTGTTATGG + Intergenic
914318054 1:146532453-146532475 CAGTCTGTGGTACTTTGTTATGG + Intergenic
914496303 1:148200904-148200926 CAGTCTGTGGTACTTTGTTATGG - Intergenic
914652725 1:149710900-149710922 CAGTCTGTGGTATTTTGTTATGG - Intergenic
914735291 1:150410762-150410784 CAGTCTGTGGTATTTTGTTATGG - Intronic
915653095 1:157333951-157333973 CAGTCTATGGTGTTCTGTCATGG + Intergenic
915681235 1:157583715-157583737 CAGTCCCTGGTGTTTGGTTATGG + Intronic
915684467 1:157617536-157617558 CAGTCTATGGTGTTCTGTCATGG - Intergenic
915714277 1:157929840-157929862 CAGTGTGTGGTGTTGGGTAATGG + Intergenic
915992981 1:160535552-160535574 AAGTCTGTGGTATTTTGTCATGG + Intergenic
916120767 1:161526007-161526029 CAGGTTGTTGTCCTTGGTCATGG - Exonic
916129796 1:161602948-161602970 CAGTGTCTGGTGCATGGTAAAGG + Intronic
916130533 1:161607640-161607662 CAGGTTGTTGTCCTTGGTCATGG - Intronic
916655334 1:166870450-166870472 CAGTCTGTGGTACTTTGTTATGG + Intronic
916880314 1:169014238-169014260 CAGTCTGTGGTATTTTGTTATGG + Intergenic
917068156 1:171120347-171120369 CAGTCTGTGGTACTTTCTTATGG - Intergenic
917124000 1:171670157-171670179 CAGTTTGTGGTACTTAGTTATGG - Intergenic
917173876 1:172209363-172209385 CAGTCTGTGGTGTATTGTTATGG + Intronic
917284978 1:173414122-173414144 CAGTCTGTGGTACTTTGTGATGG - Intergenic
917426657 1:174921223-174921245 CAGTCTGTGGTACTTTGTTATGG + Intronic
917870294 1:179235556-179235578 CAATCTGTGGTACTTTGTTATGG + Intergenic
917960645 1:180141660-180141682 CAGTTTGTGGTACTTTGTTAAGG + Intergenic
917969402 1:180197369-180197391 CAGTCTCTCCTGCTTGGTCTTGG + Exonic
918130376 1:181622379-181622401 TAGTCTGTGGTGTTTTGTTATGG - Intronic
918506673 1:185262573-185262595 CAGTCTGTGGTATTTTGTTATGG - Intronic
918586809 1:186197649-186197671 CAGTCTGTGGTATTTTGTTATGG - Intergenic
918588001 1:186209884-186209906 CAGTTTGTGGTACTTAGTTATGG + Intergenic
918710894 1:187728702-187728724 CAGTCTGTGGTATTTTGTTATGG + Intergenic
918940703 1:190992861-190992883 CAGTCTGTGGTACTTTGTTATGG - Intergenic
919117816 1:193303174-193303196 CAGTCTATGGTGTTTTGTTATGG - Intergenic
919123159 1:193365893-193365915 CAGATTGTGGTGCTTGATGATGG + Intergenic
919155387 1:193758554-193758576 CAGTCTGTGGTACTTTGTTATGG - Intergenic
919307730 1:195864550-195864572 CAGTCTGTGGTACTTTATTATGG + Intergenic
919537423 1:198805519-198805541 CAATCTGTGGTACTTTGTTATGG + Intergenic
919590013 1:199490024-199490046 CAGTCTGTGGTATTTTGTTATGG - Intergenic
919929538 1:202212411-202212433 CAGTTTGCGGTACTTTGTCACGG - Intronic
920161634 1:204002970-204002992 CAGTCTGTGGTATTTTGTTATGG + Intergenic
920201098 1:204260101-204260123 CAGTTTGGGGAGCTGGGTCAGGG - Intronic
920746663 1:208635485-208635507 CAGTTTGTGGTACTTCGTTATGG + Intergenic
920828323 1:209443254-209443276 CAGTCTGTGGCAATTTGTCATGG + Intergenic
921214654 1:212926829-212926851 CAGTCTGTGGCACTTTGTTATGG - Intergenic
921260220 1:213379598-213379620 CAGTTTGTGGTACTTTGTTATGG + Intergenic
921298088 1:213723313-213723335 CTGTCTGTGATGCTTTGTTATGG - Intergenic
921409007 1:214814619-214814641 TAGTCTGTGGTACTTTGTTAGGG + Intergenic
921411031 1:214836522-214836544 CAATCTGTGGCGCTTTGTTATGG + Intergenic
921770235 1:219028105-219028127 CAGTCTGTGGTGCTTTATTATGG - Intergenic
921914333 1:220590301-220590323 CAGTCTGTGGTATTTTGTGATGG - Intronic
921970558 1:221143991-221144013 CAGCCTGTGGTACTTTGTTATGG - Intergenic
922093800 1:222423647-222423669 CAGTCTGTGGTATTTTGTTATGG - Intergenic
922333799 1:224601740-224601762 CAGTCTGTTGAGCTTTGTAATGG + Intronic
922598090 1:226829112-226829134 AAGTCTGTGATGCTAGGCCAGGG - Intergenic
922874684 1:228931219-228931241 CAGTCTGTGGCACTTTGTTAGGG - Intergenic
922918119 1:229275469-229275491 CAGTTTGTGGTTCTTTGTGATGG + Intronic
922931107 1:229390407-229390429 CAGTCTGTGGTGCTTTCTTACGG + Intergenic
922953061 1:229575305-229575327 CAGTCTGTAGTACTTTGTTATGG + Intergenic
922978309 1:229803264-229803286 CGGTCTGTGGTGCTTTGTCATGG + Intergenic
923064218 1:230503405-230503427 CAGTCCTTGGTACTTGGTTATGG + Intergenic
923189320 1:231605448-231605470 CAGTCTGTGGTACTTTGCTATGG - Intronic
923469928 1:234281392-234281414 CAGTCTGTGGTGCCTCCTTATGG + Intronic
923512657 1:234665878-234665900 CACTCTGAGGCCCTTGGTCATGG - Intergenic
923660260 1:235951252-235951274 CAGTCGGTGGTACTTTGTTATGG + Intergenic
923681746 1:236124123-236124145 CAGTCTGTGGCACTTTGTCATGG + Intergenic
923972311 1:239218276-239218298 CAGTCTGTGCTATTTTGTCATGG + Intergenic
923977222 1:239276749-239276771 CAATCTGTGGTACTTTGTTATGG + Intergenic
924319378 1:242832082-242832104 CAGTCTGTGGTACTTTGTTGTGG + Intergenic
924493315 1:244561468-244561490 CAGTTTGTGGTACTTTGTTACGG - Intronic
924800627 1:247327533-247327555 CAGTCTGTGGTACTTTGTTATGG + Intronic
924829429 1:247577720-247577742 CACTCTGTGGTCCTTTGTTATGG - Intergenic
924831479 1:247600180-247600202 CATGCAGTGGTGCTTGGTGAAGG - Intergenic
1062876375 10:946006-946028 CAGCCTGTGGTGTTTTGTTACGG + Intergenic
1063652047 10:7947446-7947468 CATTCTGTGGTGTTAGGTAAGGG + Intronic
1063716071 10:8528443-8528465 CAGTCTGTGTTACTTTGTGATGG + Intergenic
1063754516 10:8991964-8991986 CTGTCTGTGGTACTTTGTGATGG + Intergenic
1063990321 10:11554365-11554387 CAGTCTGTGGTGCTTGTGAATGG - Intronic
1064314852 10:14245829-14245851 CAGTCTGTGGTGCTTTATTACGG + Intronic
1064318707 10:14281521-14281543 CAGTCTGTGGTACTTTATTATGG + Intronic
1064517312 10:16165817-16165839 CAGGCTGAGGTGCTTGCTGAAGG - Intergenic
1064555323 10:16541767-16541789 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1064570192 10:16684716-16684738 CCGTTTGTGGTACTTGGTTATGG + Intronic
1064804455 10:19114731-19114753 CAGTCTGAGGTACTTTGTTATGG - Intronic
1064859320 10:19809727-19809749 CAGTCAGTGGTGTTTTGTCGTGG + Intergenic
1065235697 10:23649386-23649408 CAGTCTATGGTACTTTGTTATGG - Intergenic
1065390604 10:25176929-25176951 CAGACTTTGCAGCTTGGTCAGGG + Intronic
1065455882 10:25906240-25906262 CAGTCTGTGGCACTTTGTTATGG + Intergenic
1065480351 10:26187316-26187338 CAGTCTATGGTACTTTGTTATGG - Intronic
1065654914 10:27938512-27938534 CAGTCTGTGGTATTTTGTTATGG + Intronic
1065803396 10:29372962-29372984 CAGTCTATGGTGTTTTGTTATGG - Intergenic
1065920408 10:30387830-30387852 CAGTCTGTGGTATTTTGGCATGG - Intergenic
1066057465 10:31695435-31695457 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1066388908 10:34963231-34963253 CAGTTGGTGGTGTTTTGTCATGG + Intergenic
1066660660 10:37736302-37736324 CAGTCTTTGGTATTTTGTCATGG - Intergenic
1066661097 10:37738795-37738817 CTGTCTGTGGTGCTTTGTGATGG + Intergenic
1066664939 10:37773543-37773565 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1066690776 10:38025655-38025677 CAGTCTGTGGTATTTTGTTATGG + Intronic
1066780153 10:38936474-38936496 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1067069604 10:43122090-43122112 CCGTCTGTGCAGCTTGGCCAGGG + Intronic
1067171858 10:43913300-43913322 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1067215508 10:44299547-44299569 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1067260398 10:44684838-44684860 CAATCTGTGCTCCTTTGTCAAGG + Intergenic
1067278007 10:44851547-44851569 CAGTCCGTGGTACTTTGTTATGG - Intergenic
1067353301 10:45497965-45497987 CAGTCTGTGGTATTTTGTTATGG + Intronic
1067363513 10:45603053-45603075 CAGTCTGTGATACTTTGTTATGG + Intergenic
1067410634 10:46061045-46061067 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1067834679 10:49631210-49631232 CAGTCTGTGGTACTTTGTTACGG - Intronic
1068142979 10:53029170-53029192 CAATCTGTGGTGCATAGGCACGG - Intergenic
1068149815 10:53117494-53117516 TAGTCTGTGGTGTTTTGTTATGG + Intergenic
1068483454 10:57625664-57625686 CAGTCTGTGGTACTTTCTTAAGG - Intergenic
1068487220 10:57675701-57675723 CAGTCTATGGTATTTTGTCATGG - Intergenic
1068501360 10:57842794-57842816 CAGTTTGTGGTACTTGCTTATGG - Intergenic
1068828466 10:61466186-61466208 CAGTCTGTGGTACCTTGTTATGG + Intergenic
1068849729 10:61723514-61723536 TAGCCTGTGGTGCTTGGCTATGG - Intronic
1069027868 10:63563173-63563195 CAGTCTGTGGTATTTTGTCAGGG + Intronic
1069182728 10:65383387-65383409 CAATCTATGGTACTTTGTCATGG - Intergenic
1069358348 10:67613753-67613775 CAGTCTGTGGTATTTTGTTATGG - Intronic
1069517512 10:69090386-69090408 CAGTCCGTGGTACTTTGTTATGG - Intronic
1069700158 10:70418335-70418357 CAGTCTGTGGTATTTTGTTATGG + Intronic
1069840405 10:71336040-71336062 CAGTTTGTGGTACTTGGTGAAGG - Intronic
1069963346 10:72092356-72092378 CAGTCTGTGGTACTTTGTTACGG - Intergenic
1069980072 10:72246280-72246302 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1070199523 10:74190364-74190386 CAGTCAGTGGTGATTGCTTAGGG + Intronic
1070348900 10:75573067-75573089 CAGTCTGTGGTGTTTTGTTGTGG + Intronic
1070473322 10:76806772-76806794 CAGTTTGTGGTTCTTTGTTATGG - Intergenic
1070610625 10:77929852-77929874 CAGTTTGTGGTCATTGGTTATGG + Intergenic
1070701520 10:78604883-78604905 CTGGCTGTGGTGCTTGGTGGTGG + Intergenic
1070872478 10:79768779-79768801 CAGTCTATGGTGTTTTGTTATGG - Intergenic
1070916678 10:80159553-80159575 CAGTCTGTGGTATTTTGTCATGG + Intronic
1070972840 10:80581714-80581736 CAATCTGTGGTACTTCGTTATGG + Intronic
1070987101 10:80698512-80698534 TAGTCTGTGGTGTTTTGTTATGG - Intergenic
1071273351 10:84029393-84029415 CAGTCTGTGATGCTTTGTGATGG + Intergenic
1071374374 10:84987521-84987543 CAGTCTGTGGTACTTTGTTCTGG + Intergenic
1071415915 10:85441262-85441284 CTGTCTGTGGAACTTGGTTATGG + Intergenic
1071639400 10:87290931-87290953 CAGTCTATGGTGTTTTGTTATGG - Intergenic
1071655838 10:87447018-87447040 CAGTCTATGGTGTTTTGTTATGG + Intergenic
1072162036 10:92777087-92777109 CAGTCTGTAGTACTTTGTTATGG + Intergenic
1072275345 10:93817198-93817220 CAGTATGTGGTGTATGGTAATGG + Intergenic
1072573761 10:96681003-96681025 CAGTCTATGGTGTTTTGTTATGG - Intronic
1073529773 10:104220326-104220348 CAGTCTGTGGTACTTTGCTATGG + Intronic
1073546887 10:104357008-104357030 CAGTTTGTGGTGCTTTGTTATGG - Intronic
1073993507 10:109290603-109290625 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1074033463 10:109713090-109713112 CAGTCTGCGGTACTTTGTGATGG - Intergenic
1074181403 10:111068037-111068059 CAGTGTGTGGTACTTTGTTATGG + Intergenic
1074227810 10:111504736-111504758 CAGTCTGTGGCACTTTGTTATGG - Intergenic
1074268727 10:111931291-111931313 CAGTTTGTGGTGCTTTTTAATGG - Intergenic
1074269126 10:111935660-111935682 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1074670617 10:115786302-115786324 TAGTCTGTGGTAATTGGTTATGG - Intronic
1074857788 10:117486106-117486128 CAGTCTGTGGTCCTTCATCATGG - Intergenic
1074942348 10:118247877-118247899 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
1075317817 10:121466447-121466469 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1075343257 10:121663842-121663864 CAGCCTGTGGAACTTTGTCATGG - Intergenic
1075407884 10:122206624-122206646 CAGTCTGTGGTCCTTGGTGATGG + Intronic
1075621892 10:123934212-123934234 CAGTTTGTGGTGCTGGGCTATGG - Intronic
1075803798 10:125170689-125170711 CAGTTTGTGGTGATTTGTTATGG - Intergenic
1075827722 10:125374105-125374127 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1075877925 10:125823193-125823215 CAGTCTGAGGTGCGGGGTCCTGG - Exonic
1076274209 10:129182829-129182851 TAGTCTGCGGTACTTTGTCATGG - Intergenic
1076408145 10:130226981-130227003 CAGTCTGTGGTCCTTTGCTATGG - Intergenic
1076513315 10:131027561-131027583 CTGTGGGTGGTGCTTGGCCAGGG - Intergenic
1076557891 10:131341348-131341370 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
1077082806 11:732613-732635 CAGTCTGAGTTGCTGGGACAAGG - Intergenic
1077094924 11:795253-795275 CAGTCTGGGGTGGTGGGTGAGGG - Intronic
1077128757 11:958339-958361 CCGTCTGGGGTGTTTTGTCATGG + Intronic
1077379273 11:2221228-2221250 CAGTCTATGGTACTTAGTTATGG + Intergenic
1077398901 11:2343092-2343114 CTGTCTGCGGTGCTTTGTGATGG - Intergenic
1077492323 11:2867377-2867399 CTGTCTGTGATGCTTTGTGATGG + Intergenic
1078025300 11:7689412-7689434 TAGTTTGTGGTACTTTGTCATGG - Intergenic
1078387818 11:10908392-10908414 CAGTTTGTGGTGCTTGGTTGTGG - Intergenic
1078481742 11:11682478-11682500 CAGTCTGTGGTAGTTTGTTACGG + Intergenic
1078550960 11:12280398-12280420 CAGTCTGTGGTGCTTTGTTATGG - Intronic
1078634245 11:13033993-13034015 CAATTTGTGGTGCTTTGTTACGG + Intergenic
1079284125 11:19114075-19114097 CAGTCTGTGGTACTTTCTTATGG + Intergenic
1080125947 11:28733937-28733959 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1080253192 11:30258838-30258860 CAGTCTATGGTATTTTGTCATGG + Intergenic
1080430366 11:32192455-32192477 CAGTCTGTGGTACTTTGTCATGG + Intergenic
1080719037 11:34831396-34831418 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1080847969 11:36042942-36042964 CAATTTGTGGTACTTGGTTATGG + Intronic
1080878512 11:36298166-36298188 CAGTCTGTGATATTTTGTCATGG - Intronic
1080905336 11:36539371-36539393 CAGTCTGTGGTGTTTTGTTATGG + Intronic
1081164762 11:39793924-39793946 CAGTCTGTGGTACTTTTTTATGG + Intergenic
1081381074 11:42416068-42416090 CAGTCGGTGGTACTTTGTTATGG - Intergenic
1081803961 11:45879743-45879765 CAGTCTGTGGTACTTTGTCATGG - Intronic
1082098448 11:48151121-48151143 CAGTTTGTGGTGCTTTTTTATGG - Intronic
1082637556 11:55614994-55615016 CAGTTTGTGGTGCTTTGTTATGG + Intergenic
1082755519 11:57072184-57072206 CAGTGTGTGGTACTTTGTTATGG - Intergenic
1083055930 11:59819734-59819756 CAGCCTGTGATACTTTGTCATGG - Intergenic
1083268288 11:61557407-61557429 CAGTCTCTCTTGCTTGGCCATGG + Intronic
1083354641 11:62057108-62057130 CAGTCTATGGTGTTTTGTTATGG + Intergenic
1083473849 11:62902846-62902868 CAGTTTGTGGTACTTTGTTACGG + Intergenic
1084158339 11:67328799-67328821 CAATCTGTGGTTCTTTGTTATGG + Intronic
1084469130 11:69345019-69345041 CAGCCTGTGGAACTTGGTTAAGG + Intronic
1084535561 11:69754278-69754300 CCGTCTGTGGTGCTTTGTCATGG + Intergenic
1084715199 11:70869250-70869272 CTGTCTGTGGTGCTTTATGACGG + Intronic
1084721658 11:70909882-70909904 CGGTCTGTGGTGCTTAGTGATGG - Intronic
1084747469 11:71182355-71182377 CAGTTTGTGGTACTTTGTCGTGG - Intronic
1085185761 11:74574862-74574884 TAGTCTGTGGTACTTTGTTATGG - Intronic
1085598847 11:77836556-77836578 CAGTCTGTGGTATTTTGTAATGG + Intronic
1085753882 11:79187931-79187953 CAGTCTGTGCTACTTTGTTATGG + Intronic
1085898325 11:80666479-80666501 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1086339831 11:85837496-85837518 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1086536531 11:87853530-87853552 CAGTCTATGGTACTTTGTTATGG + Intergenic
1086573504 11:88311927-88311949 CAGTCTGTGGTACTTTGTTATGG + Intronic
1086665986 11:89482639-89482661 CAGTCTGTGGTACTTTGTTATGG + Intronic
1086727784 11:90209976-90209998 AGGTCTGTGGAGCTTGGGCAAGG - Intronic
1086865410 11:91973745-91973767 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1086908511 11:92445175-92445197 CAGTCTATGGTACTTTGTTATGG + Intronic
1086925440 11:92635097-92635119 CAGTCTGTGGTCTTTGGTGATGG + Intronic
1088015491 11:105053857-105053879 CTGTTTGTGGTGATTTGTCATGG + Intronic
1088047256 11:105469002-105469024 CAGTCTGTGGTACTTTGTTTTGG - Intergenic
1088073968 11:105824140-105824162 CAGGCTGTGGTGTTTTGTTATGG + Intronic
1088096614 11:106108058-106108080 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1088115879 11:106312412-106312434 TAGTCTGTGGTACTTTGTTATGG + Intergenic
1088589154 11:111387898-111387920 CAGTGTGTGGTGCTCAGTAATGG - Intronic
1088609784 11:111566069-111566091 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1088850239 11:113698224-113698246 CGGTCTGTGGTACTTAGTCATGG + Intronic
1089131468 11:116215626-116215648 CAGACTGTGGGGCTGGCTCATGG - Intergenic
1089445230 11:118546607-118546629 CAGTCTATGGTACTTTGTTATGG + Intronic
1089576753 11:119449935-119449957 CAGTGTGTGGTACTTTGTTATGG + Intergenic
1089769792 11:120794736-120794758 CAGTCTGTGGTGCTTTGTAATGG + Intronic
1090024045 11:123152689-123152711 CAGTCTGTGGTACTTTGTTTTGG + Intronic
1090053132 11:123398188-123398210 CAGTCTGTGGTATTCTGTCATGG - Intergenic
1090877003 11:130799061-130799083 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1091205954 11:133821247-133821269 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1091496925 12:980817-980839 CAGTCTGTGGTATTTTGTTATGG - Intronic
1091634305 12:2185739-2185761 CTGTCTGTGGCACTTTGTCAGGG + Intronic
1091837972 12:3599205-3599227 CAGTCTGGGTTCCATGGTCAAGG + Intergenic
1092010830 12:5111084-5111106 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1092044085 12:5414752-5414774 CAGTCTATGGTACTTTGTTATGG - Intergenic
1092048895 12:5454051-5454073 CAATTTGTGGTGCTTTGTTACGG - Intronic
1092056047 12:5508790-5508812 CAGTCTGTAGGGCTTTGTTAAGG + Intronic
1092310883 12:7351297-7351319 CAGTCTGTGGTATTTTGTTATGG - Intronic
1092429196 12:8396187-8396209 CTGTCTGGGAGGCTTGGTCATGG - Intergenic
1093270536 12:17055251-17055273 CAGTCTATGGTATTTTGTCATGG - Intergenic
1093405418 12:18798440-18798462 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1093475418 12:19549342-19549364 CAGTTTGTGGTAGTTGGTTAGGG - Intronic
1093519104 12:20027284-20027306 CAGTCTGTGGTATTTTGTCATGG + Intergenic
1093803956 12:23409705-23409727 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1093830037 12:23744787-23744809 CAGTCTGTGGTACTTTGTTATGG - Intronic
1093972713 12:25389761-25389783 GAGTCTGTGGTGCTTTGTTATGG + Intergenic
1093984162 12:25509983-25510005 AAGTTTGTGGTGCTTTGTGAAGG + Intronic
1094146348 12:27232376-27232398 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1094357624 12:29595280-29595302 CAGTCAGTTGTGCTTGGCCAAGG - Intronic
1094438235 12:30445426-30445448 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1094616826 12:32043463-32043485 CAGTTTGTGGTGCTTTGTTATGG - Intergenic
1094771829 12:33671491-33671513 CAGTCTGTGGTGTTTTGATATGG - Intergenic
1095043935 12:37477810-37477832 CAGTCTGTGGTATTTTGTGATGG + Intergenic
1095120237 12:38408534-38408556 CAGTCTGTGGTACCTTGTTATGG + Intergenic
1095267186 12:40174231-40174253 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1095396000 12:41762961-41762983 CAGTCTATGGTGTTTTGTTACGG + Intergenic
1095418777 12:42003478-42003500 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1095636453 12:44439849-44439871 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1095638294 12:44456948-44456970 CAGTCTGTGGTACTTTGGTATGG + Intergenic
1095676094 12:44919816-44919838 CAGTTTGTGCTGCTTTGCCATGG + Intronic
1095693336 12:45116400-45116422 CAATCTGTGGTACTTTGTTATGG - Intergenic
1095906398 12:47382589-47382611 CATTCTGTGGTGCGTTGTTATGG - Intergenic
1095932835 12:47646424-47646446 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1096924847 12:55132623-55132645 CAGTGTGTGGTGTTTTGTTATGG + Intergenic
1097308172 12:58091533-58091555 CAGTCTGTGGTACTTTGTTAGGG + Intergenic
1097393771 12:59048168-59048190 CAGTCTGTGCTACTTTGTTATGG + Intergenic
1097644055 12:62214822-62214844 CAGTCTATGGTACTTTGTTATGG + Intronic
1097863133 12:64537781-64537803 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1097876990 12:64652851-64652873 TTGTTTGTGGTGCTTTGTCAAGG - Intronic
1098096723 12:66964734-66964756 CAGTCTGTGGTAATTTGTTATGG - Intergenic
1098358543 12:69633128-69633150 CAGTCTATGGTACTTTGTTATGG + Intergenic
1098525492 12:71482256-71482278 CAGTCTGTGGTACTTTGTTATGG - Intronic
1098706398 12:73695953-73695975 CAGGCTGTGGTACTTTGTTATGG + Intergenic
1099004851 12:77224060-77224082 CAGTGTGTAGTGCTTTGTTATGG + Intergenic
1099182422 12:79483707-79483729 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1099277154 12:80591168-80591190 CAGGCTGGGGTGCTGGGGCACGG + Intronic
1099453987 12:82842618-82842640 CAGTCTGTGGTGGTCTGTTACGG - Intronic
1099504477 12:83455788-83455810 CAGTTTGTGGTGCTCTGTTATGG + Intergenic
1099518206 12:83624917-83624939 CAGTCTGTGGTGTTCTGTTATGG + Intergenic
1099674069 12:85734043-85734065 CAGTCTGTGGTACTTCATTAAGG - Intergenic
1100063466 12:90610355-90610377 CAGTTTGTGGTATTTTGTCATGG + Intergenic
1100164769 12:91903881-91903903 CAGTCTGTGGTAATTGGCTATGG + Intergenic
1100190904 12:92190637-92190659 CAGTCTGTGCTACTTTGTTATGG + Intergenic
1100218978 12:92483274-92483296 CAGTCTGTGGTGCTTTGTTATGG + Intergenic
1100379923 12:94051888-94051910 CAGTCTATGGTACTTTGTTATGG - Intergenic
1100389825 12:94138756-94138778 CAGTCTGTGATACTTTGTTATGG + Intergenic
1100541394 12:95560834-95560856 CAGTCTGTGGGACTTTGTTATGG + Intergenic
1100713934 12:97286111-97286133 CAGTCATTGGTGTTGGGTCAAGG + Intergenic
1100857721 12:98772872-98772894 CGGTCTGTGGTACTTTGTTATGG + Intronic
1101071613 12:101081649-101081671 CAGTCTGTGGTACTTTGTTATGG - Intronic
1101323221 12:103692032-103692054 CAGTCTGTGGTACATTGTTATGG - Intronic
1101561875 12:105864498-105864520 CAGTCTGTAGTACTTTGTTATGG - Intergenic
1101615487 12:106332565-106332587 CAGTCTGTGGTACTTTGTTATGG - Intronic
1101702329 12:107185909-107185931 CAGTGTGTGGTGTTTTGTTATGG + Intergenic
1102014157 12:109636828-109636850 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1102188665 12:110969243-110969265 CAGTGTGTGGTACTTCGTTATGG + Intergenic
1102475868 12:113188011-113188033 CAGTCTGTGGTATTTTGTCATGG - Intronic
1102649674 12:114430639-114430661 CAGTCTGTGGTATTTAGTTACGG - Intergenic
1102784770 12:115595511-115595533 CAGTCTGTGGTGCTTGGCTATGG + Intergenic
1103091000 12:118098042-118098064 CAGGCTGGGGTGGTTGGTTAGGG - Intronic
1103156699 12:118691485-118691507 CAGTCTATGGTGTTTTGTTATGG - Intergenic
1103196673 12:119049653-119049675 CAGTCTGTGGCATTTTGTCATGG - Intronic
1103496063 12:121363164-121363186 CAGTGTGTGGTGCTTTGTTATGG - Intronic
1103730773 12:123026467-123026489 CAGTTTGTGGTTCTTTGTTATGG + Intronic
1103894796 12:124265752-124265774 CAGTGTCTGATGCTTGGCCAGGG - Intronic
1103900602 12:124301860-124301882 CAGTCTGTGGCACTTTGTCACGG - Intronic
1103938765 12:124490571-124490593 CAGTTCCTGGTGCTTGGTGATGG - Intronic
1103963725 12:124625030-124625052 CTGTCTGCGGTGCTTTGTCACGG - Intergenic
1104013874 12:124949893-124949915 CTGTGTGTGGTGCTTTGTCCTGG + Intronic
1104037571 12:125108227-125108249 CAGCCTGTGGTGTTTCGTTATGG - Intronic
1104267811 12:127252843-127252865 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1104374923 12:128257211-128257233 CAGTTTGTGGTACTTTGTTAAGG - Intergenic
1104471301 12:129032020-129032042 AGGTCTGTGGTGCTTGGTTCTGG + Intergenic
1104510951 12:129377323-129377345 CAGTGTGTGGTGCTTTGTTTTGG + Intronic
1104577470 12:129980792-129980814 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1104588918 12:130068860-130068882 CAGTCTGTGGCACTTTGTTATGG - Intergenic
1104654248 12:130561256-130561278 TGGTCTGTGGTCCTTTGTCATGG + Intronic
1104922191 12:132296231-132296253 CAGTCTGTGGTGATCTGTCACGG + Intronic
1104968655 12:132521245-132521267 CAGGCTGTGGGGCTGGGGCAGGG + Intronic
1105673557 13:22645609-22645631 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1105755875 13:23463826-23463848 CAGGCTGTGGTGCTTTGCTATGG + Intergenic
1105809589 13:23983137-23983159 CAGGCTGTGGTGTTTTGTGATGG - Intronic
1106084174 13:26525518-26525540 CAGGCTGTAGTACTTTGTCATGG - Intergenic
1106102298 13:26705604-26705626 CAGTCTGTGGTATTTTGTGATGG - Intergenic
1106110594 13:26773173-26773195 CAGTTTGTGGTGTTTTGTTATGG - Intergenic
1106139626 13:27001303-27001325 CGGTCTGTGGGGCTTGGTTTTGG + Intergenic
1106333768 13:28764324-28764346 CAGTCTGTGTTACTTTGTCATGG - Intergenic
1106454578 13:29916031-29916053 CAGTCTGTAGTACTTTGTCATGG + Intergenic
1106470526 13:30050214-30050236 CAATTTGTGGTACTTTGTCATGG - Intergenic
1106594804 13:31126895-31126917 CAGTCTGTGGTCATTAGTTATGG + Intergenic
1106637336 13:31543112-31543134 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1106650631 13:31686434-31686456 CAGTTTGTGGTACTTTGTGATGG - Intergenic
1106759842 13:32857836-32857858 CAGTCTGTGGTATTTGCTCATGG + Intergenic
1106764600 13:32901417-32901439 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1106773945 13:32990551-32990573 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1106823983 13:33499298-33499320 CAGTCTTTGGTATTTTGTCATGG - Intergenic
1106938919 13:34754645-34754667 CAGTCACTGGTGCTTGGTTATGG - Intergenic
1106948539 13:34856016-34856038 CTGTGTGTGTTGCTTGGTTAAGG + Intergenic
1107043784 13:35974895-35974917 CAGTATGTGGTACTTTGTTATGG + Intronic
1107153944 13:37144747-37144769 CAGTGTGTGGTGCTGTGTTATGG + Intergenic
1107498592 13:40953615-40953637 CAGTCTGTGGTACTTTCTTATGG + Intronic
1107660926 13:42638370-42638392 CAGTCTGTGGTATTTTGTTACGG + Intergenic
1107710123 13:43143078-43143100 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1107759881 13:43666679-43666701 CAGTTTGTGGTGCTTTGTTAAGG + Intronic
1107997857 13:45878422-45878444 CAGTCTGTGTTACTTGGTTACGG + Intergenic
1108324524 13:49317094-49317116 CTGTCTGTGGTACTTTGTTATGG + Intronic
1108430690 13:50350824-50350846 TAGTCTGTGGTGTTTTGTTAAGG - Intronic
1108517670 13:51218433-51218455 CTGTCTGTGGTACTTTGTAATGG + Intergenic
1108783209 13:53862699-53862721 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1109238580 13:59854326-59854348 CAGTTTGTGGTAATTGGTTATGG + Intronic
1109560912 13:64049173-64049195 CAGTCTGTGGTATTTGGTTATGG - Intergenic
1109894347 13:68664634-68664656 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1110514298 13:76391282-76391304 CAGTCTTTGGTGCTTTATGAAGG - Intergenic
1110544206 13:76738014-76738036 CGGTTTGTGGTACTTGGTTATGG + Intergenic
1110624057 13:77631839-77631861 CAGTCTGTGGTATTTTGTTATGG - Intronic
1110781190 13:79466888-79466910 CAGTCTGTGGTGTTTTCTTATGG - Intergenic
1110954746 13:81540089-81540111 TAGTCTGTGGTGTTTTGTTATGG + Intergenic
1111207973 13:85036806-85036828 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1111512579 13:89286456-89286478 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1111681176 13:91443469-91443491 CAGTCTGTAGTATTTTGTCATGG + Intronic
1111906345 13:94260334-94260356 CAGTCTGTGGTACTTTGATATGG - Intronic
1111953050 13:94725617-94725639 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1111999537 13:95196942-95196964 CTGTCAGTGCTGCTGGGTCATGG - Intronic
1112121700 13:96419574-96419596 CAGTTTGTGGTACTTTGTTATGG - Intronic
1112315738 13:98360631-98360653 CAGTCTGTGGTACTTCGTTATGG + Intronic
1112379824 13:98878247-98878269 CAGTCTGTGGTACTTTATTATGG + Intronic
1112411112 13:99164423-99164445 CAGTCTGTGGTCCTTTGTTATGG + Intergenic
1112418291 13:99224062-99224084 CAGTCTGTGGTATTTTGTTATGG - Intronic
1112456494 13:99567958-99567980 CATTCTGTGGTGCTTTATTATGG - Intergenic
1112584546 13:100706776-100706798 CAGCCTGTGGTACTTGGTTATGG - Intergenic
1112593709 13:100788544-100788566 CAGTCTGTGGTACTTTTTTATGG + Intergenic
1112665321 13:101565117-101565139 AAGTTTGTGGTGCTTTGTTATGG + Intronic
1112713051 13:102152291-102152313 CAATCTGTGGTACTTTGTTATGG - Intronic
1112775819 13:102843271-102843293 CTGTCTGTGGTGTTTTGTTATGG - Intronic
1112793635 13:103030271-103030293 CAGCCTGTGCTGCCTGGACATGG + Intergenic
1113086148 13:106571279-106571301 CAGTCTGTGGTAATTTGTCGGGG - Intergenic
1113101047 13:106719491-106719513 CAGTCTGTGGTGTTTTCTCATGG - Intergenic
1113240006 13:108327161-108327183 CAGTTTGTGGTATTTTGTCATGG - Intergenic
1113285609 13:108845317-108845339 CAGACTGTGGTGTTTTGTCATGG - Intronic
1113399018 13:109974478-109974500 CAGTCTGTGGTGCTTTGTTATGG + Intergenic
1113521056 13:110941306-110941328 CAGTTTGTGTTGCTTTGTTATGG - Intergenic
1113667349 13:112149884-112149906 CAGTCTATGGTCCTTTGTCATGG + Intergenic
1113670442 13:112172100-112172122 CTGTCTGTGGTCATTTGTCAGGG - Intergenic
1113822813 13:113227207-113227229 CACTCTATGGTGTTTTGTCATGG - Intronic
1113838288 13:113343835-113343857 CTGGCTGTGGTGCTGGGTCAAGG - Intronic
1113978548 13:114251664-114251686 CAGTCTGTGGTATTTTGTTATGG - Intronic
1114362991 14:21996669-21996691 CAGTCTGTGATACTTTGTTATGG + Intergenic
1114402239 14:22420641-22420663 CAGTTTGTGGTACTTTGTTAAGG + Intergenic
1114635002 14:24182400-24182422 CAGCCTGTGGAGCCAGGTCAGGG + Exonic
1114874283 14:26696487-26696509 TAGTCTGTGGTATTTTGTCATGG - Intergenic
1114965199 14:27950409-27950431 CAGCCTGTGGTACTTTGTTAGGG + Intergenic
1115292477 14:31788088-31788110 AAGTCTGTGGTTCTTGTTCTTGG + Intronic
1115329649 14:32182332-32182354 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1115375612 14:32672338-32672360 CAGTCTGTGGTATTTTGTTATGG - Intronic
1115404917 14:33004183-33004205 CAGTGTGTGTTGCTTAATCACGG + Intronic
1115448993 14:33524626-33524648 CAGTTTGTGATACTTTGTCATGG - Intronic
1115582644 14:34776940-34776962 CAGTCTGTGGTATTTCGTTATGG + Intronic
1115583478 14:34786400-34786422 CAGTGTGTAGTGCTTGGTTTAGG - Intronic
1115756130 14:36527290-36527312 CGGTCTGTGGTGTTTTGTTATGG - Intergenic
1115837467 14:37424592-37424614 CAGTTTGTGGTACTTTGTTATGG + Intronic
1116037871 14:39649975-39649997 CAGGCTGTGATGCTATGTCATGG + Intergenic
1116415345 14:44671305-44671327 CCTTCTGTGGTGCTTGCTGAAGG + Intergenic
1116469947 14:45275314-45275336 CAGTCTATGGTGTTTTGTTATGG + Intergenic
1116590902 14:46771057-46771079 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1116615049 14:47124941-47124963 CAGTCTGTGGTGCTCTGCTATGG + Intronic
1116633368 14:47361430-47361452 CAGTCTGTGGTATTTTGTCGTGG + Intronic
1116700338 14:48232970-48232992 CAGTCTTTGGTACTTTGTTATGG + Intergenic
1116806444 14:49498711-49498733 CAGTCTCTGGTACTTCGTGATGG - Intergenic
1116870745 14:50067350-50067372 CAGTCTGTGGTGCTTTGCTATGG - Intergenic
1116877327 14:50125420-50125442 CAGTTTGTGGTGCTTTGTTATGG + Intronic
1116997591 14:51339976-51339998 CAGTTTGTGGTACTTGGTTATGG - Intergenic
1117250730 14:53934830-53934852 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1117325561 14:54666082-54666104 CTGTCAGTCCTGCTTGGTCAAGG - Intronic
1117437658 14:55732376-55732398 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1117581006 14:57151641-57151663 TAGTCTGTGGTATTTGGTTATGG + Intergenic
1117630632 14:57687189-57687211 CAGTCTGTGATACTTTGTAATGG + Intronic
1118008230 14:61584460-61584482 CAGTCTGTGGCACTTAGTCATGG + Intronic
1118032120 14:61828228-61828250 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1118102797 14:62625415-62625437 CAGTCTGTGGTCCCTTGTTAGGG + Intergenic
1118351786 14:64977349-64977371 CAGTCTCTGGTACTTTGTTATGG - Intronic
1118507032 14:66424801-66424823 CAGTTTGTGGTACTTAGTTACGG - Intergenic
1118836498 14:69482010-69482032 CAGTCTGGGCTGGTTAGTCAAGG + Intergenic
1118889227 14:69894089-69894111 CAGTCTGTGGTATTTTGTTATGG + Intronic
1118919400 14:70136354-70136376 CAGTATGTGGAGCTTTGTTACGG + Intronic
1119500402 14:75122060-75122082 CAGTCTGTATTACTTGGTAAAGG - Intronic
1119508704 14:75194477-75194499 CAGTCTGTGGCGTTTTGTTATGG + Intergenic
1119616400 14:76101745-76101767 CCGTCTGTGGTGCTTTGTTAGGG + Intergenic
1119685894 14:76630935-76630957 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1119942820 14:78659312-78659334 CAGTCTGTGGTATTTTGTTATGG + Intronic
1120093788 14:80364952-80364974 CAGTCTCTTGTGCTTTGTTATGG - Intronic
1120095847 14:80386714-80386736 CAGTCTGTGGTACTTTGTTATGG + Intronic
1120144254 14:80962299-80962321 CAGTTTGTGGTACTTTGTTATGG - Intronic
1120161436 14:81149459-81149481 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1120181388 14:81345793-81345815 TAGTCTGTGGTACTTTGTTATGG + Intronic
1120221735 14:81741928-81741950 CAGTCTCTGGTGTTTTGTTATGG + Intergenic
1120289789 14:82553166-82553188 CAGTCTGTGGTGCTTTGTCATGG + Intergenic
1120367053 14:83583938-83583960 CAGTCTGTGCTACTTTGTCATGG + Intergenic
1120507755 14:85374627-85374649 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1120528767 14:85607810-85607832 CAGTCTGTGGTACTTTGTTCGGG - Intronic
1120703247 14:87721922-87721944 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1120739628 14:88093530-88093552 CAGTCTGTGCTACTTTGTCATGG + Intergenic
1120865636 14:89293329-89293351 CAGTCTGTGGCACTTGGTTATGG - Intronic
1120943220 14:89969190-89969212 CAGTTTGTGGTGCTTTGTTTTGG + Intronic
1121131150 14:91448559-91448581 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1121179734 14:91919872-91919894 CAGTCTGTGGTACTCTGTTATGG + Intronic
1121222438 14:92296665-92296687 CAGTTTGTGGTCATTTGTCATGG + Intergenic
1121426179 14:93853761-93853783 CAGTCTGGGGTACTTTGTTATGG + Intergenic
1121454436 14:94029300-94029322 CAGTTTGTGGTACTTTGTTATGG - Intronic
1121484472 14:94304122-94304144 GAGCCTGTGGTGCTTTGTTATGG + Intergenic
1121555152 14:94830890-94830912 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1121567661 14:94922906-94922928 CAGTTTGTGGTGCTTTGTTATGG - Intergenic
1121601360 14:95206527-95206549 CAATGTGTGGTACATGGTCAGGG + Intronic
1121722669 14:96121628-96121650 TAGTCTGTGGTACTTTGTTATGG + Intergenic
1121788610 14:96681830-96681852 CAGTTTGTGGTCATTGGTTAGGG + Intergenic
1121801050 14:96774478-96774500 CAATCTGTGGTACTTTGTTATGG - Intergenic
1121814847 14:96921362-96921384 CAGTCTGTGGTGATTGGTTATGG - Intronic
1122024694 14:98867285-98867307 CGCTCTGTGGTGCTTTGTCATGG + Intergenic
1122052789 14:99071400-99071422 CAGTTTATGGTACTAGGTCATGG + Intergenic
1122166423 14:99827796-99827818 CAGTCTGTAGTACTTTGTTATGG + Intronic
1122190301 14:100037114-100037136 CAGTCTGTGGTATTTTGTTATGG + Intronic
1122227675 14:100289230-100289252 CAGTGTGTGGTGTTTTGTTACGG + Intergenic
1122284593 14:100643196-100643218 CAGTCTGTGGCACTTTGTTAAGG + Intergenic
1122351988 14:101101677-101101699 CAGGGTGTGATACTTGGTCATGG + Intergenic
1122475737 14:102007768-102007790 CAGCCTGTGCTGCTTGGATATGG - Intronic
1122730568 14:103794166-103794188 CAGTCTGTGGCACTTTGTTACGG + Intronic
1122737797 14:103853729-103853751 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1122869355 14:104628966-104628988 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1122871070 14:104639312-104639334 CATTCTGTGGGACTTGGGCATGG + Intergenic
1202942478 14_KI270725v1_random:165443-165465 CAGTCTGTGGTATTTTGTGATGG + Intergenic
1123396105 15:19938115-19938137 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1123896508 15:24835995-24836017 CAGTCTCTGGTACTTTGTTATGG - Intronic
1124126398 15:26941598-26941620 CAGTGTGTGGGACTTGGTTACGG - Intronic
1124143564 15:27099288-27099310 CAGGCTGTGATGCTTGGTTATGG - Intronic
1124212457 15:27774945-27774967 CAGGCTGTGGTACTTTGTCCTGG + Intronic
1124606476 15:31173213-31173235 CAGTCTGTGGTCCTTTGTTAAGG - Intergenic
1125066680 15:35495447-35495469 CAGTTTGTGGTACTTTGTTATGG + Intronic
1125283127 15:38064360-38064382 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1125788691 15:42345892-42345914 CAGTCTGTGGTATTTTGTCATGG - Intronic
1126065740 15:44824990-44825012 CAGGCGGTGGGGCCTGGTCAGGG + Intergenic
1126094095 15:45075577-45075599 CAGGCGGTGGGGCCTGGTCAGGG - Exonic
1126209122 15:46079978-46080000 CAGCCTGTGCTGCCTGGCCAAGG - Intergenic
1126290939 15:47078053-47078075 CAGTCTGTGGTATTTTGTGATGG - Intergenic
1126303474 15:47226340-47226362 CAGTTTGTGGTACTTTGTTATGG + Intronic
1126842172 15:52727890-52727912 CAGTCTATGGTACTTTGTTATGG + Intergenic
1126896899 15:53267818-53267840 CAGTTTGTGGTATTTTGTCACGG - Intergenic
1127161863 15:56196726-56196748 AAGTCTGTGGTACTTTGTTATGG + Intronic
1127205009 15:56706650-56706672 CAATCTGTGGTACTTTGTTATGG + Intronic
1127321195 15:57848156-57848178 TAGTCTGTGGTGTTTTGTTATGG - Intergenic
1127382823 15:58444458-58444480 CAGTCTGTGGTCCTCTGTCCTGG - Intronic
1127462609 15:59213050-59213072 CAGTTTGTGGTGCTTTGTTATGG + Intronic
1127674952 15:61229550-61229572 CAGTCTGTGGCTCTCGGTCTGGG - Intergenic
1127962616 15:63900962-63900984 CAGTCTGTGATATTTGGTTATGG + Intergenic
1128367472 15:67014615-67014637 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1128645402 15:69375092-69375114 CAGTCTGTGGTATTTTGTTATGG - Intronic
1128649787 15:69402108-69402130 CAGTCTGTGATACTTTGTTATGG - Intronic
1128732766 15:70032575-70032597 CAGGCTGTGGTCCTGGGGCAGGG - Intergenic
1129176391 15:73842571-73842593 CAGTGTGTGGTACTTTGTTATGG + Intergenic
1129405247 15:75312723-75312745 CAGTCTGTGGTATTTTGGCATGG + Intergenic
1129478913 15:75807653-75807675 CAGTCTGTGGTATTTTGGCATGG + Intergenic
1129490102 15:75916283-75916305 CAGTCTGTGGTATTTTGTTATGG - Intronic
1129576385 15:76751696-76751718 CAGTATGTGGTGTTAGGTAAAGG - Intronic
1129717403 15:77860279-77860301 CAGTCTGGGGAGGTTGGTCTGGG + Intergenic
1129942067 15:79506854-79506876 CAGTCTGTGGTATTTTGTGATGG - Intergenic
1130171409 15:81518687-81518709 CAGTCTGTGGTATTTTGTTACGG - Intergenic
1130223480 15:82040981-82041003 CTGGCTGTGGGGCTTTGTCAAGG - Intergenic
1130310516 15:82749915-82749937 CAGTGTGAGGTACTTGGTTATGG + Intergenic
1130584900 15:85173278-85173300 CAGTCTGTGGTATTTTGGCATGG + Intergenic
1130904059 15:88227669-88227691 CAGTCTGTGGGACTTCGTTATGG + Intronic
1130958115 15:88641365-88641387 CAGTGTGTGGTGCTTTGTTATGG - Intronic
1131080678 15:89532038-89532060 CAGTCTGTGGTATTTTGTGATGG + Intergenic
1131183027 15:90253430-90253452 CAGTCTTGGGTGCCTGGGCAAGG - Intronic
1131315572 15:91333842-91333864 CAGTCTGTGGTATTTTGTTACGG + Intergenic
1131375680 15:91921041-91921063 CAGTCTGTGGTGTTTGCTTAGGG - Intronic
1131543168 15:93291554-93291576 CAGTCTGTGGTACTTCCTTATGG - Intergenic
1131958759 15:97765975-97765997 CAGTTTGTGGTACTTTGTAACGG + Intergenic
1131981577 15:97999675-97999697 CATTCTGTGGTACTTTGTGATGG + Intergenic
1132033380 15:98457605-98457627 CAGTCTGTGGTATTTTGTTATGG + Intronic
1132729829 16:1355902-1355924 CAGTCCCTGGTGCTTGGAGAGGG + Intronic
1132730152 16:1357073-1357095 CAGCCTGGGGTGCTTGGGCTTGG - Intronic
1133542638 16:6771279-6771301 CAGTCTACGGTGCTTTGTTACGG + Intronic
1133714220 16:8431411-8431433 CAGTCTGTAGTACTTTGTTACGG - Intergenic
1133828879 16:9303431-9303453 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1133856525 16:9554657-9554679 CAATCTGTGGTTCTTTGTCACGG - Intergenic
1133873116 16:9708197-9708219 AAGTCTGTGGTACTTTGTTATGG + Intergenic
1133977330 16:10608575-10608597 CAGTCTGAGGTGCTGTGTTATGG + Intergenic
1134506466 16:14811616-14811638 CAGTCTGTAGTACTTTGTTATGG - Intronic
1134574088 16:15317149-15317171 CAGTCTGTAGTACTTTGTTATGG + Intergenic
1134728332 16:16439152-16439174 CAGTCTGTAGTACTTTGTTATGG - Intergenic
1134873899 16:17678143-17678165 CAGTCTGTGGTGTTTTCTGATGG + Intergenic
1134939108 16:18272680-18272702 CAGTCTGTAGTACTTTGTTATGG + Intergenic
1135201590 16:20442170-20442192 CAGTCTGTTGTACTTTGTTATGG - Intergenic
1135289843 16:21225917-21225939 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1135586370 16:23674757-23674779 CAGTTTGTGGTACTTTGTTATGG - Exonic
1135680083 16:24448848-24448870 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1135798751 16:25472650-25472672 CAGTCTGTGTTCCCTGGACATGG + Intergenic
1135974074 16:27095790-27095812 CGGCCTGTGGTACTTGGTTATGG - Intergenic
1136698575 16:32110270-32110292 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1136769029 16:32817564-32817586 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1136799078 16:33053564-33053586 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1136901567 16:34044762-34044784 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1136956767 16:34796517-34796539 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1137416649 16:48288484-48288506 CAGTCTGTGGTATTTTGTTATGG - Intronic
1137869373 16:51934635-51934657 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1138141715 16:54574243-54574265 CAGTCTGTGGTATTTTGTTACGG + Intergenic
1138173168 16:54871948-54871970 CAGTTTGTGGTGTTTTGTTATGG + Intergenic
1138249465 16:55490885-55490907 CAGTTTGTGGCACTTTGTCATGG - Intronic
1138304842 16:55965168-55965190 CAGGGTGTGGTGCTTTGTTATGG - Intergenic
1138307487 16:55990507-55990529 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1138965326 16:62077553-62077575 TAGTCTGTGGTATTTTGTCACGG + Intergenic
1139318396 16:66092809-66092831 CAGTCTGTGGTGCTTTGTTATGG - Intergenic
1140557203 16:75935765-75935787 CAGTCTGTGGTACCTCGTTAGGG - Intergenic
1140650438 16:77082477-77082499 CAGTGTGTGGTGCCTGTTCTGGG - Intergenic
1140662849 16:77204498-77204520 CAGTTTGTGGTACTTTGTTATGG + Intronic
1141017979 16:80468056-80468078 CAGTCTATGGTATTTTGTCATGG + Intergenic
1141147576 16:81542561-81542583 CAGTCTATGGTGTTTTGTTATGG - Intronic
1141396763 16:83711869-83711891 CAGTCTATGGTACTTTGTTATGG - Intronic
1141398836 16:83728814-83728836 CAGTCTGTGGTATTTGGTTATGG - Intronic
1141535650 16:84677922-84677944 CAGTCTGTCATGCTTTGTTATGG - Intergenic
1141596187 16:85098230-85098252 CAGGCAGTGGTGCTTTGTCAAGG + Intergenic
1141650687 16:85391367-85391389 CAGTTTGTGGTACTTTGTTACGG - Intergenic
1142182092 16:88676269-88676291 CAGGCTGGGGTGCTTTGTTATGG + Intergenic
1203071444 16_KI270728v1_random:1079671-1079693 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1143512230 17:7403266-7403288 GAGTGTGTGGGGCTTGGTCAGGG + Intronic
1144024600 17:11266867-11266889 GAATTTGTGGAGCTTGGTCAGGG + Intronic
1144136757 17:12302477-12302499 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1144187515 17:12810204-12810226 CAGTTTGTGGTGATTTGTTATGG - Intronic
1144199274 17:12924879-12924901 CAGTCTGTGGTACTTTGTTATGG + Intronic
1144282885 17:13744607-13744629 CAGTCTGTGGTACTTGGTTATGG - Intergenic
1144803416 17:17947638-17947660 CAGTCTGTGGTATTTTGTTATGG + Intronic
1145692730 17:26760524-26760546 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1145709469 17:26957167-26957189 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1146185928 17:30724230-30724252 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1146517358 17:33499621-33499643 CAGTCTGTGGTACTTTGTTACGG + Intronic
1146551644 17:33785343-33785365 CAGTCTGTATTACTTGGTTATGG + Intronic
1146653422 17:34621192-34621214 CAGCCTGTGGAACTTTGTCATGG - Intronic
1147651590 17:42065329-42065351 GAGTCTGTGGTACTTTGTTATGG + Intronic
1147884710 17:43676793-43676815 CAGGCTGTGGTGAAAGGTCAAGG + Intergenic
1147926516 17:43949729-43949751 CAGTCTGTGATTCTTTGTTATGG + Intergenic
1147932726 17:43992966-43992988 CAATTTGTGGTGCTTTGTTATGG + Intronic
1148953751 17:51336546-51336568 CAGCCTGTGGTACTTTGTTATGG + Intergenic
1148957208 17:51363735-51363757 CAGTTTGTGGTGCTTTGCTATGG - Intergenic
1149450545 17:56746646-56746668 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1149540044 17:57461947-57461969 CAGTTTGTGGTACTTTGTTATGG - Intronic
1149881488 17:60296604-60296626 CAGTTTGTGGTGCTTTGTTATGG + Intronic
1150449008 17:65250215-65250237 CAGCCTGTGGTATTTTGTCATGG - Intergenic
1150511503 17:65757215-65757237 CAGTCTGTGGTGTTCTGTTATGG + Intronic
1150613853 17:66753925-66753947 CAGTCTGTGGTGTTTTATAAGGG + Intronic
1150897533 17:69231048-69231070 CAGTTTGTGGTACTTTGTTATGG - Intronic
1151080479 17:71323676-71323698 CTGTCTGTGGTATTTGGTTATGG + Intergenic
1151575892 17:74952425-74952447 GAGCCTGTGGTTCTGGGTCAGGG - Intronic
1151946777 17:77323899-77323921 CAGTTTGTGGCACTTGGTGATGG - Intronic
1152035863 17:77872399-77872421 CAGTCTGTGGTTCTTCGTGATGG - Intergenic
1152597033 17:81242761-81242783 CAGTCTCAGGTGCTTTGTTAGGG - Intergenic
1153450459 18:5221753-5221775 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1153617039 18:6944768-6944790 CAGTCTGTGGTACTTTGTTCTGG + Intronic
1153655718 18:7280422-7280444 CAGTCTGTGGTACTTTGTTAGGG - Intergenic
1153671700 18:7418344-7418366 CAGTCTGAGGTCCGTGGTAAGGG - Intergenic
1154129461 18:11724339-11724361 CAGCCTGTGGTGCTCTATCAGGG - Intronic
1154129632 18:11725464-11725486 CAGTCTGTGATGCTTTATTATGG + Intronic
1154213240 18:12397438-12397460 CAGTGTGGGGAGCTTGGTCTGGG + Intergenic
1154273402 18:12939145-12939167 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1155011121 18:21779561-21779583 CAGTCTTTGCAGCATGGTCATGG + Exonic
1155094187 18:22540333-22540355 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1155178691 18:23324339-23324361 CAGTCTGTGATATTTTGTCATGG + Intronic
1155337918 18:24784304-24784326 CAGTCTGTGGTACTTTGTTAAGG - Intergenic
1155347450 18:24872733-24872755 CTGTCTATGGTGCTTTGTTATGG - Intergenic
1155397215 18:25398995-25399017 CAGTCTGTGGTCTTTGGTTATGG + Intergenic
1155491157 18:26403221-26403243 CAGTCTGTGGTGCTTTGTTATGG + Intergenic
1155668065 18:28335605-28335627 CAGTCTGTGGTATTTTGTTAGGG + Intergenic
1155684366 18:28530469-28530491 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1156057377 18:33024222-33024244 CAGTCTGTGATGTTTTGTTATGG - Intronic
1156061399 18:33080636-33080658 CAGTCTGTGGTACTTTGTTAGGG + Intronic
1156413057 18:36854311-36854333 CAGTCTGTGGTACTTTGTTAAGG + Intronic
1156416402 18:36896018-36896040 CAGTCTGTGGTATTTTGTTATGG + Intronic
1156703257 18:39849855-39849877 CAGTCTGTGTTACTTTGTTATGG + Intergenic
1156819915 18:41360036-41360058 GAGGCTGTGATGCTTGGACATGG + Intergenic
1157123560 18:44934602-44934624 CAGTGCCTGGTGCCTGGTCAGGG - Intronic
1157376660 18:47173682-47173704 CAGTTTGTGCTGCTTTGTTATGG - Intronic
1157390349 18:47296874-47296896 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1158087039 18:53663358-53663380 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1158226985 18:55211423-55211445 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1158320014 18:56252040-56252062 CAGTCTGTGGTGCCTTGGTACGG - Intergenic
1158344607 18:56503547-56503569 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1158367811 18:56758869-56758891 AGGTCTGGGGTGCTTGGTCTAGG - Exonic
1158500495 18:57996411-57996433 CAGTCTGTGGAGTTTTGTTATGG - Intergenic
1158650786 18:59283087-59283109 CAGTCTGTGGTCCTTTGTCATGG + Intronic
1158698313 18:59722657-59722679 CAGTCTGTGGAACTTTGTTAGGG + Intergenic
1158721080 18:59925248-59925270 CAGTCTGTGATATTTTGTCATGG + Intergenic
1158762998 18:60412446-60412468 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1158787614 18:60734731-60734753 CAGTCTGTGGTATTTTGTGATGG - Intergenic
1158831186 18:61280937-61280959 CAGTCTGGGGTGCTTTGTAATGG + Intergenic
1158940474 18:62402595-62402617 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1159554558 18:69931863-69931885 CAGTCTGTGGTACTTTATTATGG - Intronic
1159569105 18:70091638-70091660 CAGTCTGTGGTATTTTGTTATGG + Intronic
1159776581 18:72609543-72609565 CAGACTGTGGTACTTTGTTATGG + Intronic
1159841281 18:73402008-73402030 CAGTCTGTGGTACTTTCTTATGG - Intergenic
1159949900 18:74475317-74475339 CAGACTATGGTGTTTTGTCATGG + Intergenic
1159984877 18:74830208-74830230 CAGTCTGTGGTATTTTGTTACGG + Intronic
1159989055 18:74881090-74881112 CTGTCTGCGATGCTTGGTGAGGG - Exonic
1160118035 18:76100254-76100276 CAGTCTTTGGTGTTTTGTTACGG + Intergenic
1160133037 18:76246662-76246684 CAGTTTGTGGTGTTTTGTTATGG - Intergenic
1160337917 18:78059361-78059383 CCGGCTGTGGTGCTTTGCCATGG - Intergenic
1160849190 19:1181937-1181959 CAGCCTGAGGTGCTATGTCAGGG - Intronic
1161228595 19:3160646-3160668 CAGTTTGTGGTACTTTGTTACGG - Intronic
1161516205 19:4698034-4698056 CAGTCTGTGGTCCTTTGTCATGG + Intronic
1161870724 19:6867699-6867721 CAGTCTGTAGTACTTAGTTATGG + Intergenic
1164570606 19:29371970-29371992 CACTCTGTGGTGCTTGGCAGGGG - Intergenic
1166912333 19:46167962-46167984 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1166915397 19:46192199-46192221 CAGTCAGTGGGGCAAGGTCAGGG - Intergenic
1167030259 19:46954216-46954238 CAGTCTGTGGTATTTTGTTATGG + Intronic
1167553788 19:50179845-50179867 CAGTTTCTGGTGCTTGGTTACGG + Intergenic
1167735835 19:51294070-51294092 CAGTCTGTGGGGCTTTGTTTTGG - Intergenic
1167751722 19:51384718-51384740 CAGTCTGTGGGGCTTTTTTATGG + Intronic
1168275374 19:55274998-55275020 TAGTCTGTGGTGCTTGGCTAAGG + Intronic
1168499018 19:56877877-56877899 CGGTCTGTGGTACTTTGTCATGG - Intergenic
1168519416 19:57036651-57036673 CAGTCTGTGGTACTTTATTATGG + Intergenic
925119268 2:1404722-1404744 CAGTCTGTGGTACTTTGTTATGG + Intronic
925147187 2:1589032-1589054 AAGCCTGTGGTGTTTTGTCATGG + Intergenic
925344713 2:3162714-3162736 CAGTCTATGGTATTTTGTCATGG - Intergenic
925854538 2:8116977-8116999 CACTCTGTGCTGCTTGGTCCAGG - Intergenic
925867719 2:8243777-8243799 CAGTTTGTGGAGTTTTGTCATGG + Intergenic
925870892 2:8269473-8269495 CAGTTTATGGTACTTGGTTATGG + Intergenic
925901507 2:8512490-8512512 CAGTCTGTGGTATTTTGTGATGG - Intergenic
925916814 2:8612821-8612843 CAGTCTGCGGCCCTTTGTCAGGG + Intergenic
926130108 2:10297606-10297628 CAGTCTGTGGTATTTCGTCATGG - Intergenic
926379218 2:12267815-12267837 CAGTCTGTGATACTTTGTAATGG - Intergenic
926410716 2:12599374-12599396 CAGTCTGTGGTATTTGGTTATGG + Intergenic
926590329 2:14733872-14733894 CAGTCTGTGGTATTTTGTTATGG - Intergenic
926613016 2:14966234-14966256 CAGTTTGTGGTACTTTGTAACGG + Intergenic
926628326 2:15114187-15114209 CAGCCTGTGGTACTTGGTGATGG - Intergenic
926635293 2:15171975-15171997 TAGTCTGTGGTACTTTGTTAGGG + Intronic
926778259 2:16443579-16443601 CAGTCTGTGGTACTTTGTTATGG - Intergenic
926809478 2:16743717-16743739 CAGTCTGCAGTACTTTGTCATGG + Intergenic
926814258 2:16784665-16784687 CCATCTGTGGTACTTGGTTATGG + Intergenic
926885649 2:17596082-17596104 CAGTCTGTGGTGCTTTGTTATGG + Intronic
926931827 2:18048717-18048739 CAGTCTGTGGTTCTTGGTTATGG - Intronic
926936749 2:18093525-18093547 CAGTCTGTGGTGTTTTGTGATGG + Intronic
927028911 2:19100190-19100212 CAGTTTGTGGTACTTTGTTACGG + Intergenic
927090399 2:19706379-19706401 CAGTCTGTGGTACTTTGTTATGG + Intergenic
927206476 2:20614316-20614338 CAGTTTATGGTGCTTTGCCAAGG + Intronic
927257699 2:21054552-21054574 CAGTCTGTGGTACTTTGTTAAGG - Intergenic
927423369 2:22955594-22955616 CAGTCTGTGGTATTTTGTTATGG - Intergenic
928066121 2:28166189-28166211 CAGTCTGTAGTACTTTGTTATGG + Intronic
928303334 2:30146681-30146703 GAGTCCGAGGTGCTGGGTCAGGG + Intergenic
928460910 2:31471693-31471715 CAGTCTGTAGAGCTTTGTTATGG - Intergenic
928808378 2:35190452-35190474 CAGTCTGTGCTGTTTTGTTATGG + Intergenic
928892764 2:36223612-36223634 CAGTCTGTGGTCTTTTGTTATGG + Intergenic
929079157 2:38105650-38105672 CAGTCTGTTGTACTTTGTTATGG + Intronic
929088500 2:38192196-38192218 CAGTCTGTGGTATTTTGTCATGG - Intergenic
929125254 2:38517758-38517780 CAGTCTCAGGTGCTGGGTCAGGG + Intergenic
929862547 2:45692197-45692219 CAGTTTGTGGTGCTTTGTTATGG - Intronic
930037422 2:47095555-47095577 CAGTCTGTGGTACTTTGTTATGG + Intronic
930092563 2:47541873-47541895 CAGTCCGTGGTACTTTGTTATGG + Intronic
930167342 2:48215894-48215916 TAGTTTGTGGTGCTTTGTTATGG + Intergenic
930805828 2:55488989-55489011 TAGTCTGTGGTGTTTTGTTATGG + Intergenic
930976730 2:57471814-57471836 CAGTCTGTGGCATTTTGTCATGG + Intergenic
930985278 2:57578609-57578631 CAGTCTGTGGTACTTTGTTATGG + Intergenic
931261156 2:60620474-60620496 CAGTTTGTGGTACTTTGTTAAGG + Intergenic
931447100 2:62335902-62335924 CAGTCTGTGGTATTTTGTGATGG + Intergenic
931766716 2:65463393-65463415 CAGCCTGTGGTACTTTGTTATGG + Intergenic
932047404 2:68363690-68363712 CAGTTTGTGGTACTTTGTTATGG - Intergenic
932571190 2:72939222-72939244 CAGTCTGAGGTGCTTTGTTGTGG - Intergenic
932672347 2:73749199-73749221 CAGTCTGTGGTACTTTGCTATGG + Intergenic
933283146 2:80354867-80354889 CTGTCAGGGGTGCTGGGTCAGGG + Intronic
933493293 2:83016408-83016430 GAGTCTGTGGTACTTTGTTATGG - Intergenic
933935131 2:87197500-87197522 CAGTCTGTGGTATTTTGTTATGG + Intergenic
934088573 2:88530796-88530818 CAGTCTGTGGTATTTTGTTATGG + Intergenic
934303829 2:91803692-91803714 CAGTTTGTGTTACTTGGTTATGG + Intergenic
934329425 2:92049059-92049081 CAGTTTGTGTTACTTGGTTATGG - Intergenic
934467647 2:94278976-94278998 CAGTTTGTGTTACTTGGTTATGG - Intergenic
934519356 2:95010289-95010311 CAGCCTGTGGTATTTGGTTACGG - Intergenic
934995086 2:98950330-98950352 CAGTTTGTGGTACTTTGTTATGG + Intergenic
935040092 2:99417720-99417742 CAGTCTGTGGTACTTTGTTATGG + Intronic
935192233 2:100787626-100787648 CAGTCTGTGGTACTTCGTTAGGG - Intergenic
935603118 2:104942716-104942738 CAGCCTGTGGCACTTTGTCATGG - Intergenic
935609476 2:105006125-105006147 CAGTCTGTAGTGCTTTGTTAGGG - Intergenic
935660663 2:105464124-105464146 CAGTCTGTGGTACTTTGTTACGG - Intergenic
935662160 2:105476312-105476334 CAGTCTGTGGTACTTAATAATGG - Intergenic
935700690 2:105809314-105809336 CAGTCTGTGGTACTTTCCCATGG - Intronic
935733853 2:106090175-106090197 CAGTCTCTGGTATTTTGTCACGG - Intergenic
935795298 2:106635132-106635154 CACTCTGTGGTACTTTGTTATGG + Intergenic
935981035 2:108627912-108627934 CAGTTTATGGTACTTGGTGATGG - Intronic
936265123 2:110999057-110999079 CTGTCTGTGGTATTTTGTCATGG - Intronic
936358013 2:111768398-111768420 CAGTCTGTGGTATTTTGTTATGG - Exonic
936410076 2:112249766-112249788 CAGTCTGTGGTACTTTGTTATGG + Intronic
937014085 2:118587653-118587675 TAATCTGTGGTGCTTTGTTATGG + Intergenic
937141916 2:119609345-119609367 CAGCCTGTGGTACTTTGTTATGG - Intronic
937457747 2:122057708-122057730 CAGTCTGTGGTACTTTGTTATGG - Intergenic
937480170 2:122250141-122250163 CAGTGTGTGGTAGTTTGTCATGG + Intergenic
937510511 2:122589730-122589752 CAGTCTGTGGTATTTTGTTATGG + Intergenic
937822999 2:126333379-126333401 CAGTTTGTGGTACTTCGTCATGG - Intergenic
937971243 2:127551050-127551072 CAGTCTGCAGTATTTGGTCATGG - Intronic
938153811 2:128910493-128910515 CAGTCTGTGGTATTTTGTTATGG - Intergenic
938195285 2:129321794-129321816 CAGTCTGTGGTACTTTGCCGTGG - Intergenic
938197501 2:129342244-129342266 CAGTCTGTGGTATTTTGTTATGG + Intergenic
938288864 2:130138964-130138986 CTGTCTGCGGTGCTGTGTCAGGG + Intergenic
938304420 2:130242089-130242111 CAGACTGTGGTACTTTGTAATGG - Intergenic
938467670 2:131533967-131533989 CTGTCTGCGGTGCTGTGTCAGGG - Intergenic
938518794 2:132044091-132044113 CAGTTTGTGTTACTTGGTTATGG - Intergenic
938579851 2:132636029-132636051 CAGTCTGTGGTATTTTGTTATGG + Intronic
938626040 2:133110783-133110805 CAGTCTGTGGTATTTTGTTATGG - Intronic
938672412 2:133598771-133598793 CAGTCTGTGGTCATTTGTAATGG - Intergenic
938679929 2:133679056-133679078 CAGTCTGTGGAACTTCGTTATGG - Intergenic
939042730 2:137210151-137210173 CAGTCTGTGGTATTTTGTTATGG + Intronic
939104084 2:137928813-137928835 CAGTTTGTGGTACTTTGTTATGG + Intergenic
939104803 2:137936761-137936783 CAGTCTGTGGTATTTTGTTATGG - Intergenic
939224122 2:139343581-139343603 CAGTTTGTGATGCTTTGTTATGG - Intergenic
939332487 2:140782570-140782592 CAGTCTGTGGGACTTTGTTATGG + Intronic
939394815 2:141614839-141614861 CAGTTTGTGGTACTTTGTAATGG + Intronic
939399224 2:141669416-141669438 CAGACTATGGTGCTTTGTTATGG + Intronic
939860480 2:147414458-147414480 CAGTCTGTCTTACTAGGTCAGGG + Intergenic
939897200 2:147806559-147806581 CAGTGTGTGGTACTTTGTTACGG - Intergenic
940044184 2:149391943-149391965 CAGTCTGTGGTATTTCGTTATGG - Intronic
940073638 2:149717260-149717282 CAGTCTGTGATGCTTTGTTATGG - Intergenic
940859638 2:158758560-158758582 CAGTCTGTGGTATTTTGTTATGG + Intergenic
940895185 2:159074733-159074755 CAGTCAATGGTGCTTTGTTACGG - Intronic
940988437 2:160073375-160073397 CAGTTTGTGGTACTTTGTTATGG - Intergenic
941043070 2:160644987-160645009 CAGTTTGTGGTACTTTGTAATGG + Intergenic
941489162 2:166122109-166122131 CTGTCTGTGGTACTTTGTCATGG + Intronic
941520852 2:166540461-166540483 CAGTCTATGGTGTTTTGTTATGG - Intergenic
941645115 2:168031812-168031834 CAGTTTGTGGTTCTTTGTTAAGG + Intronic
941717444 2:168778994-168779016 CAGTCTGTGGTATTTTGTAATGG - Intergenic
941963607 2:171278119-171278141 CAGTCTGTGGTATTTTGTTATGG - Intergenic
941984791 2:171499733-171499755 TAGTCTGTGGTACTTTGTTATGG - Intergenic
942068006 2:172290035-172290057 TAGTCTGTGGTACTTTGTTATGG - Intergenic
942076223 2:172359268-172359290 CAGTTTGTGGCGTTTTGTCACGG - Intergenic
942092460 2:172507372-172507394 CAGTGTGTCGTGCATAGTCATGG + Intergenic
942189266 2:173454916-173454938 CAGTTTGTGGTACTTTGTTATGG - Intergenic
942483321 2:176413175-176413197 CAGTCTGTGGTATTTTGTTATGG + Intergenic
942877301 2:180816100-180816122 CAGTTTGTGGTACTTAGTTATGG - Intergenic
942893450 2:181020115-181020137 CAATTTGTGGTACTTGGTTATGG - Intronic
943138709 2:183950474-183950496 CAGTTTGTGGTAATTTGTCATGG + Intergenic
943762451 2:191624658-191624680 CAGTCTGTGGTGCTTTGTTATGG - Intergenic
944284990 2:197939399-197939421 CAGACTGTGGTACTTTGTTATGG - Intronic
944300934 2:198123981-198124003 CTGTCTGTGGTGCTTTGTCATGG + Intronic
944525257 2:200612333-200612355 CAGTGTGTGGTTCTTTGTTATGG - Intronic
944701704 2:202251665-202251687 CAGTCTATGGTGTTTTGTTATGG - Intergenic
944935490 2:204562985-204563007 CAGTTTGTGGTACATTGTCATGG - Intronic
945029187 2:205648009-205648031 CAGTCTGTGGTATTTTGTTATGG - Intergenic
945395526 2:209311042-209311064 CAGTCTATGGTACTTTGTTACGG + Intergenic
945607766 2:211957457-211957479 CAGTCTGTGGTACTTTGTTATGG + Intronic
945815323 2:214598915-214598937 CAGTGTGTGGTGCGTTGTTATGG - Intergenic
945822310 2:214679788-214679810 CAGCCTGTGGTATTTGGTTATGG - Intergenic
945907323 2:215609789-215609811 CAGTTTGTGGTACTTTGTTATGG - Intergenic
945993647 2:216417316-216417338 CAGTCAGTGGTACTTTGTCACGG - Intronic
946242669 2:218366640-218366662 CAGCCTGTGGTGTTTTGTTATGG - Intronic
946298320 2:218804818-218804840 CAGTCTGTGGTATTTTGTTATGG - Intronic
946316035 2:218913253-218913275 CAGTTTGTGGTACTTTGTTATGG + Intergenic
946882108 2:224186676-224186698 CAGTCTGGTTTTCTTGGTCAGGG - Intergenic
947597458 2:231422164-231422186 CAGTCTGTGGTTCTCTGTTATGG - Intergenic
947818013 2:233051031-233051053 CAGTCTATGGTACTTAGTTATGG + Intergenic
947883347 2:233541565-233541587 CAGTCTGTGGCATTTTGTCATGG + Intronic
947914382 2:233822171-233822193 CAGGCTGTGGAGCATGGTCCGGG - Exonic
947922722 2:233892361-233892383 CAGTCTGGGGTACTTTGTTATGG - Intergenic
947955329 2:234184929-234184951 CAGTTTGTGGTGCTTAGTTATGG + Intergenic
948119308 2:235517037-235517059 CAGTCTGTGGTATTTTGTCGTGG - Intronic
948248377 2:236505498-236505520 CTGGCTGTGGGGCTGGGTCAAGG + Intronic
948259309 2:236591095-236591117 CAGTTTGTGGCAATTGGTCACGG - Intergenic
948286537 2:236790246-236790268 CAGTTTGTGGTACTTTGTTATGG + Intergenic
948354684 2:237368687-237368709 CAGTCTGGGGTCATTGGTGATGG + Exonic
948382077 2:237557803-237557825 CAGTTTGTGGGGCTTTGTTATGG - Intergenic
948513038 2:238484786-238484808 CAGGCTGGGGCACTTGGTCATGG + Intergenic
948648483 2:239424295-239424317 CAGTCTGTGGTGCCTTGCCATGG + Intergenic
948959143 2:241317985-241318007 CAGTTTGTGTTGCTGGATCAAGG + Intronic
948981737 2:241498129-241498151 CAGTGTCTGGAGCTTGGACAAGG - Intronic
1168934977 20:1657237-1657259 GAGTCTGTGGTGCTTTGTTGTGG + Intronic
1168940522 20:1707471-1707493 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1169005433 20:2203388-2203410 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1169054039 20:2605299-2605321 CAGTCTGTGGTACTTTGTTGTGG - Intronic
1169248486 20:4042449-4042471 CAGTGTATGGTACTTTGTCATGG - Intergenic
1169284469 20:4296468-4296490 CCGTCTATGGTGCTTTGTTATGG + Intergenic
1169330071 20:4709380-4709402 CAATCTGTGGTACTTGGTTATGG - Intergenic
1169701686 20:8454157-8454179 CAGTCTGTGGTGTTTTGTTATGG + Intronic
1169855995 20:10103504-10103526 AAGTCTGTGGTACTTTGTTATGG - Intergenic
1170073405 20:12392981-12393003 CTGTTTGTGGTACTTGGTTATGG + Intergenic
1170175491 20:13464448-13464470 CAGTCTATGGTACTTTGTTATGG + Intronic
1170302409 20:14899302-14899324 CAGTGTGTGGTGCTTTGTTATGG - Intronic
1170317662 20:15060419-15060441 AAGCCTGTGGTGCTGGGTCTTGG - Intronic
1170388946 20:15851315-15851337 CAGTCTGTGGTACTTTATGATGG - Intronic
1170462158 20:16587630-16587652 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1170475816 20:16713394-16713416 CAGTCTGTGGTATTTTGTTAAGG + Intergenic
1170558670 20:17537006-17537028 CCGTCTGTGGTGCTTTGTTCTGG + Intronic
1170861107 20:20104692-20104714 CAGTCTGTGGCACTTTGTTATGG - Intronic
1170959682 20:21014137-21014159 CAATCTGTGGTTCTTTGTTATGG - Intergenic
1171044556 20:21797893-21797915 CAGTCTGTGGTATTTTGTTACGG + Intergenic
1171369164 20:24649658-24649680 CAGGACGTGGTGTTTGGTCAGGG - Intronic
1171459080 20:25288506-25288528 CTCTCTGTGGTGTTTGGTCTGGG + Intronic
1171538463 20:25921395-25921417 CAGTCTGTGGTATTTTGTGATGG + Intergenic
1171802671 20:29640030-29640052 CAGTCTGTGGTATTTTGTGATGG - Intergenic
1173254489 20:41384508-41384530 CCGTCTTTGGTACTTTGTCATGG - Intergenic
1173292147 20:41724505-41724527 CAGTATGTGGTACTTTGTTATGG - Intergenic
1173459827 20:43234187-43234209 CAGGCTGTGGTGCTTTGTTATGG + Intergenic
1173972272 20:47161910-47161932 CAGTCTGTGGGACTTTGTAATGG - Intronic
1175068795 20:56314442-56314464 CAGTATGTGATGCTTGGTAATGG - Intergenic
1175236990 20:57521183-57521205 CAGTTTGTGGCACTTTGTCATGG + Intronic
1175238663 20:57529907-57529929 CAGTCTGTGGTGTTTTGTTACGG + Intergenic
1175324974 20:58118009-58118031 CAGTTTGTGGTATTTTGTCATGG - Intergenic
1175671906 20:60910570-60910592 CAGTCTGTGGTACTTTGCTACGG - Intergenic
1176232591 20:64039734-64039756 CAGAGTGTGGGGCTGGGTCAGGG - Intronic
1176252168 20:64130606-64130628 CAGTCTGTGGTCCTTTATTATGG + Intergenic
1176900285 21:14433024-14433046 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1176901515 21:14447956-14447978 CAGTCTGTGGTACTTTGTTACGG - Intergenic
1177210003 21:18059348-18059370 CAGTCTGTGGTATTTTGTTATGG + Intronic
1177380232 21:20331137-20331159 CAGTCTGTGGTGTTTTATTATGG - Intergenic
1177594780 21:23224485-23224507 CAGTGTGGGGTTCTTGTTCAAGG - Intergenic
1177765417 21:25451497-25451519 CAGTCTGTGCTGTTTTGTTATGG - Intergenic
1178019218 21:28390295-28390317 CAGTCTGTGGTAGTTTGTAATGG - Intergenic
1178044223 21:28676136-28676158 CAGTCTGTGGTAGTTTGTTATGG - Intergenic
1178277150 21:31249402-31249424 CAGTCTGTGGTGCTTTGCTATGG + Intronic
1178341569 21:31789854-31789876 CAGTCTGTGGTACTTTGTGGAGG - Intergenic
1178368805 21:32010096-32010118 CAGTCTGTGGTGTTTTGTTATGG + Intronic
1178376840 21:32074214-32074236 CGGCCTGTGGTGTTTTGTCACGG - Intergenic
1178484636 21:33010904-33010926 CGGTCTGTGCTACTTTGTCATGG - Intergenic
1178635136 21:34296050-34296072 CAGTCTGTGATACTTTGTTATGG - Intergenic
1178676675 21:34637070-34637092 CAGTCGGTGGTACTTTGTTATGG - Intergenic
1178712023 21:34925688-34925710 CAGTTTGTGGTACTTTGTTATGG + Intronic
1178731770 21:35110291-35110313 CAGTTTGTGGTACTTTGTTATGG - Intronic
1178772080 21:35514862-35514884 CAGTTTGTGGTACTTTGTTAAGG + Intronic
1178792307 21:35711861-35711883 CAGTCTGTGGTACTTTGTTGTGG - Intronic
1178853055 21:36229198-36229220 CAGTCTGTGGTACTTTATTATGG - Intronic
1178878637 21:36431438-36431460 AAGTTTGTGGTGCTTTGTTACGG + Intergenic
1178883971 21:36470602-36470624 CAGGTTGTGGTGCTTTGTCATGG + Intronic
1178911040 21:36673951-36673973 CAGTTTGTGGTGATTTGTTACGG + Intergenic
1179019901 21:37629724-37629746 CAGTCTGTGGTACTTTGTTATGG + Intronic
1179034207 21:37745886-37745908 CAGTTGGTGGTACTTTGTCACGG - Intronic
1179061962 21:37987728-37987750 CAGTCTGTGGTATTTTGTTATGG - Intronic
1179107312 21:38413979-38414001 CATTTTGTGGTACTTGGTTACGG - Intronic
1179108437 21:38424372-38424394 CAGTCTGTGGGGCTCTGTGAAGG + Intronic
1179136001 21:38680360-38680382 CAGTCTGTGGTCCTTTGAAATGG - Intergenic
1179164797 21:38926955-38926977 CAGTCTGTGGTTCTTTGTTATGG + Intergenic
1179173005 21:38987535-38987557 CCGTTTGTGGTGCTTTGTTATGG - Intergenic
1179179977 21:39036643-39036665 CAGTTTATGGTGCTTTATCAGGG + Intergenic
1179408436 21:41143884-41143906 CAGCTTGTGGTGCTTTGTTATGG - Intergenic
1179416263 21:41200894-41200916 CAGTCTGCGGTGCTTTGTTCTGG + Intronic
1179438029 21:41375368-41375390 CAGTCTGTGGTCTTTTGCCATGG - Intronic
1179642634 21:42757508-42757530 CAGTCTCTGGTACTTTGTTATGG - Intronic
1179654127 21:42834647-42834669 CTGTCTTTGGTGCTTGGGAATGG + Intergenic
1179715682 21:43286380-43286402 CAGTGTGTGGTTCTTTGTTATGG + Intergenic
1179720116 21:43311512-43311534 CGGTTTGTGGTGCTTGGTTATGG - Intergenic
1179802007 21:43815469-43815491 CAGCCTGTGGTCCTTTGTCACGG - Intergenic
1180123042 21:45766565-45766587 CAGTCTGTGGTGTTCTGTTATGG + Intronic
1180700267 22:17777729-17777751 GGGTCTGTGGTGCTCGGCCATGG + Intergenic
1180748360 22:18107894-18107916 CAGTCTGTGGTATTTAGTGATGG - Intronic
1180937313 22:19634245-19634267 CAGCCTGTGGTACTTCATCATGG + Intergenic
1181010607 22:20038309-20038331 TGGTCTGTGGTGCTTAGTTACGG + Intronic
1181146563 22:20852484-20852506 CAGTCTGTGGTACTTTGTTATGG + Intronic
1181506763 22:23363703-23363725 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1181677224 22:24463361-24463383 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1181816052 22:25437670-25437692 CAGTCACTGGTGCTGCGTCAAGG + Intergenic
1181925383 22:26354495-26354517 CGGTTTGTGGTCCTTTGTCAAGG + Intronic
1182029763 22:27148771-27148793 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1182084457 22:27551706-27551728 CAGACTGGGGTGTTTTGTCATGG + Intergenic
1182425516 22:30269668-30269690 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1182534602 22:30991322-30991344 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1182619012 22:31608152-31608174 CAGTCTGTGGTACTTTGTCATGG - Intronic
1182810922 22:33116010-33116032 CAGTCTGTGGTATTTTGTTACGG + Intergenic
1182822868 22:33233727-33233749 CAGTCTGTGGTACTTTGTTATGG - Intronic
1182842379 22:33401836-33401858 CAGTCTGTGGTATTTTGTTACGG + Intronic
1182901641 22:33903376-33903398 CAGTCTATGGTACTTTGTTATGG + Intronic
1183017970 22:35005601-35005623 CAGTCTGTGGTACTTTGTCATGG + Intergenic
1184057014 22:42059457-42059479 CAGGCTGAGGTGCTGGGCCAGGG + Exonic
1184283818 22:43454925-43454947 CAGTCTCTGGTACATGGTCAGGG - Intronic
1184454773 22:44603383-44603405 CAGCCTGTGGTACTTTGTTATGG - Intergenic
1184587587 22:45458358-45458380 CAGTCTGTGGGGCTTTGTCATGG - Intergenic
1184592257 22:45492939-45492961 CAGTCTGTGGTCCTTCATTATGG - Intergenic
1185125606 22:49009089-49009111 CAGTTTGTTGTACTTGGTCGTGG - Intergenic
1185176318 22:49329003-49329025 TAATCTGTGGTGCTTTCTCAGGG + Intergenic
1185226925 22:49658461-49658483 CAGTTTGTGGTCCTTTGTCACGG - Intergenic
1203237953 22_KI270732v1_random:24980-25002 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1203289704 22_KI270735v1_random:23383-23405 CAGTTTGTGTTACTTGGTTATGG - Intergenic
949185782 3:1189977-1189999 CAGTCTGTGGTATTTTGTTATGG - Intronic
949237323 3:1825292-1825314 CAGTCTGTGGTATTTTGTTAGGG + Intergenic
949306398 3:2646635-2646657 CAGTCAGTGGTACTTTGTTAAGG - Intronic
949398205 3:3637592-3637614 CAGTCTGTGGTACTTGGTAGTGG - Intergenic
949420084 3:3856359-3856381 CAGTCTATGGTACTTTGTTATGG - Intronic
949684738 3:6555825-6555847 CAGTCTGTGGTATTTTGTTACGG - Intergenic
949719123 3:6968036-6968058 CAGTTTGTAGTGCTTTGTTATGG - Intronic
949914806 3:8951772-8951794 CAGTCTGTGGTATTTTGTTATGG - Intronic
950130617 3:10543267-10543289 CAGTCTGTGGTATTTTGTTATGG + Intronic
950141147 3:10616468-10616490 CAGTCTGTGGCACTTTGTTATGG + Intronic
950367483 3:12497799-12497821 GAGTCTGTGGTACTTTGTTATGG - Intronic
950749352 3:15116632-15116654 CAGTCTGTGGTACATTGTCATGG - Intergenic
950778516 3:15371438-15371460 CAGTCTGTGGTCTTTTGTTATGG - Intergenic
950844435 3:16000808-16000830 CAGTTTGTGGTACTTTGTTATGG - Intergenic
950963846 3:17132335-17132357 CAGTCTGTGGTAATTTGTCCTGG - Intergenic
951351641 3:21614100-21614122 CAGTCTGTGGTATTTTGTTATGG - Intronic
951362700 3:21743437-21743459 CAGTCTGTGGTTTTTTGTCATGG - Intronic
951373956 3:21889734-21889756 CAGTTTATGGTACTTTGTCATGG - Intronic
951628495 3:24692882-24692904 TAGTCTGTGGCACTTTGTCATGG + Intergenic
951680583 3:25290468-25290490 CAGTCTATGGTGTTTTGTTATGG + Intronic
951930564 3:27962399-27962421 GACTCCGTGGTGCTTGGCCATGG - Intergenic
951969246 3:28424666-28424688 CAGTCTGTGGTATTTTGTTATGG + Intronic
952011494 3:28905261-28905283 CAGTCTGTGGTATTTTGTTATGG - Intergenic
952059022 3:29484259-29484281 CAGTCTGTGGTACTTTGTTATGG - Intronic
952182419 3:30932192-30932214 CAGTCTGTGGTACTTTGTTATGG - Intergenic
952199904 3:31115323-31115345 TAGTCTGTGGTACTTGGTTATGG + Intergenic
952234417 3:31464074-31464096 CAGTCTGTGGTACTCTGTTAGGG + Intergenic
952286613 3:31975630-31975652 CAGTCTTTGGTTCTGGATCAGGG - Intronic
952710843 3:36430662-36430684 CAGTCTGTGGTACTCTGTTATGG - Intronic
953236721 3:41113497-41113519 CAGTCTGTGGTACTTTATTATGG + Intergenic
953502610 3:43452426-43452448 CAGTATGTGGTCCTTTGTGATGG + Intronic
953547444 3:43873985-43874007 TAGTCTGTGGTACTTTGTCATGG + Intergenic
954367168 3:50152385-50152407 CAGGCTGTGGTGCCTGGAGAAGG - Intergenic
954758672 3:52858150-52858172 CAGTCTGTGATATTTGGTTATGG + Intronic
954787185 3:53102337-53102359 CAGTCTGTGGTACTTTGTCATGG + Intronic
954927456 3:54248741-54248763 CAGTCTGTGGTACTTTGTTATGG + Intronic
955375446 3:58392115-58392137 CAGCCTGTTGTTCTTGGTGAAGG + Intronic
955879800 3:63531212-63531234 CAGTTTGTGATGCTTTGTTATGG - Intronic
956040597 3:65141099-65141121 CAGTCTGTGGTATTCTGTCATGG + Intergenic
956338653 3:68194681-68194703 CAGTTTGTGGTACTTTGTTATGG + Intronic
956707091 3:72008406-72008428 CAGTATGTGGTACTTTGTTATGG + Intergenic
956723020 3:72134854-72134876 CAGTTTGTGGTACTTTGTTAGGG + Intergenic
956752388 3:72353649-72353671 CAGTTTGTGGTACTTTGTTACGG + Intergenic
956849348 3:73214002-73214024 CAGTTTGTGGTACTTTGTTATGG + Intergenic
957020093 3:75117025-75117047 CAGTCTATGGTACTTTGTTATGG + Intergenic
957159047 3:76584681-76584703 TAGTCTGTGGTACTTTGTTATGG + Intronic
957386984 3:79508451-79508473 CAATCTGTGGTGCTTTGTTATGG + Intronic
957634484 3:82762361-82762383 CCTTCTGTGGTGCTTGCTGAAGG + Intergenic
957671189 3:83304561-83304583 CAGTTTGTGGTTCTTTGTTATGG + Intergenic
957918873 3:86722668-86722690 CAGTCTATGGTATTTGGTAATGG + Intergenic
958528735 3:95295768-95295790 CAATCTGTGGTATTTTGTCAAGG + Intergenic
958706833 3:97666329-97666351 CAGTTTGTGCTGCTTTGTTATGG - Intronic
958711041 3:97717374-97717396 CAGTCTGTGGTGTTTTGTTATGG - Intronic
958803748 3:98784958-98784980 AAGTGTGTGGTGGTTGGTAATGG + Exonic
958824705 3:99016362-99016384 CAGTCTGTGATATTTGGTAATGG - Intergenic
958979548 3:100705468-100705490 CAGTCTGTGGTGTTTTGTTATGG - Intergenic
959019858 3:101177285-101177307 CACTTTGTGGTACTTGGTTATGG - Intergenic
959167509 3:102799085-102799107 CAGTCTGTGGAACTCTGTCATGG - Intergenic
959175816 3:102908863-102908885 CAGTCTGTGGTACTTCATTATGG - Intergenic
959405537 3:105958326-105958348 CAGTCTGTGGTATTTTGTTATGG - Intergenic
959495677 3:107048678-107048700 CAGTCTGTGGTATTTTGTTACGG - Intergenic
959498330 3:107076690-107076712 CAGTCTGTGGCACTTTGTTATGG - Intergenic
959677080 3:109048563-109048585 CAGTCTGTGGTATTTTTTCACGG - Intronic
959828217 3:110827126-110827148 CAGCCTGTGGTACTTTGTTATGG + Intergenic
960153685 3:114276343-114276365 CAGTCTGTGGTATTTTGTTATGG - Intergenic
960633155 3:119753961-119753983 TAGTCTATGGTGTTTGGTTATGG + Intronic
960677983 3:120215693-120215715 CAGCCTGTGGTGTTTTGTTATGG - Intronic
960704274 3:120467021-120467043 CAGTCTGTGATACTTTGTTAAGG + Intergenic
960724466 3:120656275-120656297 CAGTCTGTGGTATTTTGTTATGG + Intronic
961327610 3:126118588-126118610 CAGTCTGCGGAGCTTTGACATGG + Intronic
961560315 3:127724139-127724161 CAGTCTGTGGTCCTTTGTTATGG + Intronic
961908584 3:130289355-130289377 CAGTGTGTGGTGCTTTGTTATGG + Intergenic
961967201 3:130918187-130918209 CAGTGTGTGATGCTTGGTTCTGG + Intronic
962091854 3:132252501-132252523 CAGTCTGTGGTACTTTGTTATGG + Intronic
962254064 3:133858393-133858415 CAGTCTGTGGTACTTTGTTATGG - Intronic
962640887 3:137385300-137385322 CAGTCTGTGGTATTTTGTTATGG - Intergenic
962940161 3:140118273-140118295 CAGTCTGTGGTACTTGGTTGTGG + Intronic
963238646 3:142981125-142981147 CAGTCTATGGTACTTTGTTATGG - Intronic
963469997 3:145728473-145728495 CAGGCTGTGGTATTTTGTCATGG - Intergenic
963559526 3:146845479-146845501 GAGTCTGAATTGCTTGGTCAAGG + Intergenic
963616892 3:147551591-147551613 CAGTCTGTGGTATTTTGTTACGG - Intergenic
963746300 3:149128061-149128083 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
963877950 3:150497802-150497824 CAGTCTGTGGTATTTTGTTATGG + Intergenic
964100181 3:152979483-152979505 CAGTCTGTGATACTTCGTTATGG - Intergenic
964369040 3:155980553-155980575 CGGTCTGTGGTGTTTTGTTATGG - Intergenic
964466408 3:156997982-156998004 CAGTCTGGCCAGCTTGGTCACGG + Intronic
964476369 3:157101138-157101160 CAGTCTGTGGTATTTTGTTATGG + Intergenic
964856786 3:161154518-161154540 CAGTCTATGGTGCTTTGTTATGG + Intronic
965192852 3:165553631-165553653 CAGTTTGTGGTACTTTGTTATGG + Intergenic
965449442 3:168819547-168819569 CAGTTTGTGGTACTTTGTTATGG - Intergenic
965561877 3:170069821-170069843 CAGCCTGTGGTGGTTTGTTATGG - Intronic
965696936 3:171418830-171418852 CAGTCTGTGGTATTTTGTTATGG - Intronic
965751401 3:171978386-171978408 CAGTTTGTGGTACTTTGTTATGG - Intergenic
965794786 3:172428484-172428506 CAGTCTGTGGTATTTTGTGATGG - Intergenic
965943943 3:174217379-174217401 CAGTCTATGGTATTTTGTCAGGG - Intronic
965966215 3:174493551-174493573 CAGTCTGTGGTAGTTTGTTATGG + Intronic
966107632 3:176356379-176356401 CAGTCTGTGGTAGTTTGTTAAGG - Intergenic
966150019 3:176857551-176857573 CAGTCTGTGGTGTTTTTTTATGG - Intergenic
966282295 3:178246112-178246134 CAGTCTGTGATAATTGGTTAGGG - Intergenic
966387090 3:179410393-179410415 CAGCTTGTGGTGCTTTGTTATGG - Intronic
966409699 3:179635424-179635446 CAGTCTGTGGTACTTTGTTAGGG + Intergenic
966437980 3:179909956-179909978 CAATCTGTGGTACTTTGTCATGG + Intronic
966617945 3:181932179-181932201 TAGTCTGTGGTACTTTGTTATGG + Intergenic
967229669 3:187325516-187325538 CAGTTTGTGGTACTTTGTTATGG - Intergenic
967281374 3:187827193-187827215 CAGTCTGTGATACTTTGTTATGG + Intergenic
967543843 3:190700170-190700192 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
967595814 3:191325918-191325940 CAGTCTGTGGTATTTTGTTATGG + Intronic
967835558 3:193959633-193959655 CAGTCTGTGGTATTTTGTTATGG + Intergenic
967964415 3:194949755-194949777 CAGTCTGTGGTGTTTTGTTGTGG - Intergenic
967968205 3:194979271-194979293 CACTCTGTGGTACTTGGTTATGG - Intergenic
968507290 4:976706-976728 CAGTCTGTGGTCTTCTGTCACGG - Intronic
968564075 4:1300508-1300530 CAGTCTCTGTTGTTTGGTCAGGG + Intronic
968849870 4:3071942-3071964 CGGTCTGTGGTACTTTGTTATGG + Intergenic
969089392 4:4682367-4682389 AAGTCTGTAGTACTTTGTCATGG - Intergenic
969202870 4:5619604-5619626 CAGTTTGTGGTACTTTGTTATGG + Intronic
969210698 4:5685007-5685029 TAGTCTGTGGTACTTTGTTATGG + Intronic
969220991 4:5758314-5758336 CAGTTTGCGGCGCTTTGTCATGG + Intronic
969305743 4:6325421-6325443 CAGCCTGTGGCGCCTGGGCAGGG - Intronic
969349138 4:6588126-6588148 CAGTCTGTGGTCCTTTGTTATGG - Intronic
969449540 4:7265119-7265141 CAGTCTGTGGTCCTTAGTTACGG - Intronic
969598791 4:8163598-8163620 CAGTGTGAGGTGCATGGCCAGGG + Intergenic
969622336 4:8284877-8284899 CAGTCTGTGGTACTTTGTTATGG - Intronic
969834820 4:9832074-9832096 TAGTCTGTGCTATTTGGTCATGG + Intronic
969943558 4:10759642-10759664 CAGTCTGTAGTACTTTGTCATGG + Intergenic
969973002 4:11067223-11067245 CAGTTTGTGGTACTTTGTCATGG - Intergenic
969996706 4:11319797-11319819 CAGTTTGTGGTACTTTTTCATGG - Intergenic
970016518 4:11518132-11518154 TAGTCTGTGGTACTTTGTTATGG + Intergenic
970166111 4:13240245-13240267 CACTCTATGGTACTTTGTCATGG + Intergenic
970443334 4:16103856-16103878 CAGTCTGTGGTACTTTGTTATGG - Intergenic
970454025 4:16203762-16203784 CAGTCTATGGTACTTTGTTATGG + Intronic
970546222 4:17133138-17133160 CAGTCTGTGGTATTTTGTTATGG - Intergenic
970582120 4:17483009-17483031 CACTCTGTGGTGTTTTGTTATGG - Intronic
970858112 4:20671838-20671860 CAGTCTGTGGTCCTTTGTTATGG + Intergenic
970872032 4:20827239-20827261 CAGTCCGTGGTATTTTGTCATGG - Intronic
970954611 4:21795375-21795397 CAGTCTGTGGTATTTTGTTATGG + Intronic
971091768 4:23353860-23353882 CAGTCTGTGGTGCCTTGTCATGG - Intergenic
971338367 4:25744962-25744984 CAGTATTTGGTACTTGGTTATGG + Intergenic
971669240 4:29534261-29534283 CAGTCTGTGGTTCTTTGTAATGG + Intergenic
972363916 4:38355581-38355603 CAGTTTGTGGTAATTTGTCATGG + Intergenic
972417756 4:38859411-38859433 CAGTCTGTGGTGATTTGTCATGG + Intergenic
972581767 4:40401368-40401390 CAGTCTGTAGTGTTTTGTTATGG + Intergenic
972705174 4:41535324-41535346 CAATCTGTGGTACTTTGTTATGG - Intronic
972722746 4:41716843-41716865 CAGTTTGTAGTTCTTTGTCATGG + Intergenic
972936831 4:44146786-44146808 TAGTCTGTGGTACTTTGTTATGG - Intergenic
972958745 4:44425167-44425189 CAGTCTGTGGTACTTTGTTAAGG + Intronic
972974260 4:44614081-44614103 CAGTCTGTGGTACTTTGTTATGG + Intergenic
973601597 4:52548049-52548071 CAGTCTGTGGTACTTTGTTATGG - Intergenic
973791064 4:54378627-54378649 CAGTCTGTGGTATTTTGTTATGG - Intergenic
973960062 4:56100837-56100859 CAGTTTGTGGTAGTTGGTTATGG + Intergenic
973976023 4:56263371-56263393 TAGTCTGTGGTACTTTGTTATGG - Intronic
974020905 4:56691481-56691503 CGGTCTGTGGTACTTTGTTATGG - Intergenic
974088985 4:57291048-57291070 CAGTCTGTAGTGTTTTGTTATGG - Intergenic
974193369 4:58537194-58537216 CAGTCTGTGGTAATTGGTTATGG - Intergenic
974225688 4:59039767-59039789 CAGTCTGTGGTAGTTTATCATGG + Intergenic
974316896 4:60294284-60294306 CAGTCTGTGGTATTTTGTTATGG + Intergenic
974417997 4:61635680-61635702 CAGTCTGAGGTTCTTGGTTATGG - Intronic
974466043 4:62257952-62257974 CGGACTGTGGTGCTTTGTTATGG - Intergenic
974930850 4:68359307-68359329 CAGTCTGTGGTATTTTGTTATGG + Intergenic
975297375 4:72750239-72750261 CAGACTGTTGTGCTGGGTCTTGG - Intergenic
975413041 4:74077314-74077336 CACTCTGTGGTACTTTGTTATGG - Intergenic
975430736 4:74287882-74287904 CTGTCTGTGGTACTTTGTTATGG - Intronic
975828075 4:78340642-78340664 CAGTCTGTGGTATTTTGTTATGG - Intronic
976285296 4:83365207-83365229 CAGTCTGTGGCACTTTGTTATGG - Intergenic
976304029 4:83541702-83541724 CAGTCTGTGGTACTTTGTTATGG - Intronic
976397627 4:84573142-84573164 CAGTCTGTGGTATTTTGTGATGG + Intergenic
976559566 4:86485988-86486010 CAGTCTGTGGTATTCTGTCATGG + Intronic
976663828 4:87568919-87568941 CAGTCTGTGGTATTTTGTAATGG - Intergenic
976704366 4:88006397-88006419 CAGTCTCTGGTACTTTGTTATGG + Intergenic
976803345 4:89018448-89018470 CAGTCTGTGGTATTTTGTTAGGG + Intronic
976832473 4:89330880-89330902 CAGTCTGTGGTACTTTGTTAGGG - Intergenic
976956579 4:90908915-90908937 CAGTTTGTGGTACTTTGTTACGG - Intronic
977021087 4:91760999-91761021 CAGTCTGTGGTACTTTATTATGG + Intergenic
977162498 4:93652709-93652731 CAGTCCATGGTACTTGGTTATGG + Intronic
977165457 4:93689240-93689262 CAGTCTGTGGTACTTTGTTATGG + Intronic
977208856 4:94194819-94194841 CAGTCTGTGGAACTTTGTTAGGG - Intergenic
977247179 4:94646479-94646501 CAGTCTGTGGTACTTTGCTAAGG + Intronic
977365591 4:96063925-96063947 CAGTCTGTGGTGTTCTGTTATGG + Intergenic
977401599 4:96539486-96539508 CAGTCTGTGGTATTTTGTTAAGG + Intergenic
977432140 4:96943580-96943602 CAGTTTGTGGTACTTTGTTATGG + Intergenic
977466728 4:97391387-97391409 CAGTTTGTGGTAATTTGTCATGG + Intronic
977673148 4:99718669-99718691 TAGTCTGTGGTACTTTGTTATGG + Intergenic
978006705 4:103626087-103626109 CAGTCTGTGATACTTTGTTATGG + Intronic
978063234 4:104364530-104364552 CAGTCTCTGCTGCTTAGTCTGGG + Intergenic
978178493 4:105764432-105764454 CAGTCTGTGGTCTTTTGTTATGG - Intronic
978207003 4:106091367-106091389 CAGTGGGAGGTGTTTGGTCATGG - Intronic
978250021 4:106619465-106619487 CAGTCTGAGGTGCTTTGTTATGG - Intergenic
978360791 4:107929518-107929540 CAGTCTGTAGTACTTTGTTATGG - Intergenic
978528603 4:109691981-109692003 CAGTCTGTGGTACTTTGTTATGG + Intronic
979092616 4:116504756-116504778 CAGTTTGTGGTACTTTGTTAGGG - Intergenic
979368434 4:119853222-119853244 CAGTCTGTGGTATTTTGTTATGG + Intergenic
979504324 4:121478607-121478629 TAGTTTGTGGTGCTTTGTTACGG + Intergenic
979940320 4:126753940-126753962 CAGTCTGTGGTACTTTGTTATGG + Intergenic
979954592 4:126936186-126936208 CAGTTTGTGGTACTTGGTCATGG + Intergenic
980104742 4:128577003-128577025 CAGTCTGTGGTATTTTGTTATGG - Intergenic
980595808 4:134952856-134952878 CAATCTGGGCCGCTTGGTCAAGG - Intergenic
980598277 4:134985029-134985051 CAGTCTGTGGTATTTTGTAATGG + Intergenic
980650823 4:135712458-135712480 CAGTCTGTGGTAATTATTCATGG + Intergenic
980740066 4:136938969-136938991 CAGTCTGTGGAACTTTGTTATGG + Intergenic
980800410 4:137741275-137741297 CAGTCTGTGGTACTTTGTTACGG + Intergenic
980876438 4:138666796-138666818 CAGTCTGTGGTACTTTGTTTTGG - Intergenic
980978000 4:139629494-139629516 CAGTCTGTGGTATTTTGTTATGG - Intergenic
981009039 4:139905582-139905604 CAGTCTGTGGTATTTTGTTATGG - Intronic
981130511 4:141153554-141153576 CAGTCTGTGGTAATTTGTTATGG + Intronic
981161408 4:141503379-141503401 CAGTCTGTGGTATTTTGTAATGG + Intergenic
981168377 4:141590367-141590389 TAGTCTATGGTGCTTTGTTATGG + Intergenic
981353724 4:143762925-143762947 CATTCTGTGGTACTTTGTTATGG - Intergenic
981358846 4:143824318-143824340 CAATCTGTGGTGCTTTATTACGG - Intergenic
981444422 4:144819174-144819196 CAGTCTGTGGTACTTTGTTATGG - Intergenic
981484751 4:145273659-145273681 CAGTCTGTGGTATTTTGTTATGG + Intergenic
981497682 4:145412065-145412087 CAGTCTGTGGTATTTTGTCATGG + Intergenic
981707170 4:147672047-147672069 CAGTCTGTGGTATTTCGTTATGG + Intronic
981717978 4:147770807-147770829 CAGTCTGTGGTACTCGGCTATGG - Intronic
981719821 4:147790043-147790065 CAGTCTGTGGTATTTTGTTATGG - Intronic
981788309 4:148505500-148505522 CAGTCTGTGGTACTTTATTATGG + Intergenic
981845047 4:149157635-149157657 CAGTCTGTGGTATTTTGTTATGG + Intergenic
982116733 4:152104431-152104453 CAGCCTGTGGTCCTTTGTCACGG + Intergenic
982170216 4:152654821-152654843 CAGTCTGTGGTATTTTGTTATGG + Intronic
982213768 4:153062813-153062835 TAGTTTGTGGTGCTTTGTTATGG + Intergenic
982334675 4:154220889-154220911 CAGTGGGTGCTGTTTGGTCATGG + Intergenic
982345113 4:154348826-154348848 CAGTGCGTGGTGCTTTGTTATGG + Intronic
982445620 4:155487352-155487374 CAGTCTGTGGTATTTTGTTATGG + Intergenic
982446990 4:155503485-155503507 CAGTTTGTGGTACTTTGTTATGG + Intergenic
982492166 4:156043089-156043111 CAGCCTGTGGTGTTTTGTTATGG - Intergenic
982650559 4:158083144-158083166 CAGTTTGTGGTGATTTGTTATGG - Intergenic
982729419 4:158940037-158940059 CTGTCTGTGATACTTGGTTATGG - Intronic
983053947 4:163080228-163080250 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
983259799 4:165443412-165443434 CAGTCTGTGGTATTTTGTTATGG - Intronic
983280694 4:165677376-165677398 CAGTTTGTGGTGATTTGTTATGG + Intergenic
983367001 4:166804185-166804207 CAGCCTGTGGTACTTTGTTATGG - Intronic
983433597 4:167682819-167682841 CAATCTGTGGTACTTAGTTATGG + Intergenic
983625816 4:169800997-169801019 CAGTCTGTGGTACTTTGTTATGG - Intergenic
983684177 4:170388608-170388630 CACTTTGTGGTGCTTTGTTATGG - Intergenic
983804489 4:171977354-171977376 CAGTCTGTGGTACTTTATTATGG - Intronic
983850264 4:172571144-172571166 CAGTCTATGGTACTTTGTTATGG + Intronic
983954266 4:173678348-173678370 CAGTCTGTGGTGCTTTGCTATGG + Intergenic
983960185 4:173742968-173742990 CATTCTGTGGTACTTTGTTATGG + Intergenic
984420474 4:179514675-179514697 CAGTCTGTGGTATTTTGTTATGG + Intergenic
984425997 4:179586352-179586374 CAGTCTGTGGTACTTTGTTATGG + Intergenic
984441803 4:179780402-179780424 CAGTATGTGGTACTTTGTTAGGG - Intergenic
984539897 4:181024440-181024462 CAGTTTGTGGTCCTTTGTTATGG - Intergenic
984623129 4:181975835-181975857 CAGTTTGTGGTACTTTGTTATGG - Intergenic
984632269 4:182073538-182073560 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
984706790 4:182853073-182853095 CCGTCTGTGGTACTTTGTTACGG + Intergenic
984721443 4:182976902-182976924 CAGTCTGTGGTGTTCTGTTATGG + Intergenic
984730874 4:183066869-183066891 CAGTCTGTGGTACTTCGTTAAGG + Intergenic
984958953 4:185075447-185075469 CAGTTTGTGGTGCTTCATGATGG + Intergenic
985010737 4:185579912-185579934 CAGTCTCTGGTACCTGGTTATGG - Intergenic
985026895 4:185747295-185747317 CAGTCTGTGGTACTTTGTTATGG + Intronic
985266779 4:188158455-188158477 CACTCTGTGATTCTTGGTCAGGG - Intergenic
985349346 4:189040763-189040785 CAGTCTCTGGTACTTCGTTACGG - Intergenic
985378868 4:189371472-189371494 CAGTCTATGGTGCTTTGCTATGG - Intergenic
985562474 5:596434-596456 CAGTCTGTGGTATTTTGACATGG - Intergenic
985798358 5:1982809-1982831 GAGTCTCTGGGGCTTGGTGAGGG - Intergenic
986011359 5:3718752-3718774 GAGTCTGTGGGGCTTTGTTATGG + Intergenic
986221709 5:5774577-5774599 CAGTCTGTGGTGCTTTGTGATGG - Intergenic
986241874 5:5967519-5967541 AAGTCTATGGTACTTGGCCATGG - Intergenic
986295196 5:6431809-6431831 CAGTCTGTGGTACTTTATTATGG - Intergenic
986510412 5:8500493-8500515 CAGCCTGTGGTACTTTGTCCTGG + Intergenic
986570868 5:9163931-9163953 CAGTCTATGGTACTTTGTTATGG + Intronic
986576609 5:9219742-9219764 CAGGCTGTGATACTTTGTCATGG + Intronic
986741938 5:10712296-10712318 CAGTCTGTGGCACTTTGTTAAGG + Intronic
986746806 5:10751909-10751931 CAGTCTGTGGTATTTTGTTAAGG + Intronic
986769189 5:10956389-10956411 CAGCCTGTGGTACTTTGTTATGG - Intergenic
986860319 5:11919964-11919986 CAGTCTGTGGTGTTTTGTTGTGG - Intergenic
986895966 5:12368534-12368556 TAGTCTGTGGTATTTTGTCAGGG + Intergenic
986989757 5:13538039-13538061 TAGTTTGTGGTGCTTTGTGATGG + Intergenic
987005533 5:13706030-13706052 CAGTCGGTGGTACTTTGTTATGG + Intronic
987147946 5:15011167-15011189 CAGGCTGTGGTGCTTTGTCGTGG - Intergenic
987213690 5:15710744-15710766 CAGTTTGTGGTACTTTGTTATGG - Intronic
987263798 5:16230046-16230068 CAGTTTGTGGTGCTTTGTTACGG + Intergenic
987367452 5:17161794-17161816 CAGTTTGTGGTGTTTGGTTATGG - Intronic
987371743 5:17199772-17199794 GAGTCTGTGGTGCTTGATCTGGG + Intronic
987449370 5:18062816-18062838 CAGTCTGTGGCACTTTGTTATGG + Intergenic
987587665 5:19877072-19877094 AAGTCTGTTGTGCATGGTGAGGG - Intronic
987603840 5:20107552-20107574 CAATCTGTGGTACTTTGTTATGG - Intronic
987689902 5:21253010-21253032 CAGTCTGTGGTGGTTTGTTATGG + Intergenic
987833459 5:23129236-23129258 CAGTCTGTGGTATTCTGTCATGG - Intergenic
987992510 5:25232335-25232357 CAGTCTTTGGTATTTGGTTATGG - Intergenic
988029412 5:25743388-25743410 TAGTCTGTGCTACTTTGTCATGG - Intergenic
988189526 5:27910486-27910508 CAGTTTGTGGTACTTTGTTATGG - Intergenic
988241142 5:28610486-28610508 CAGTCTGTGGTACTTTGTTATGG + Intergenic
988258595 5:28852400-28852422 CAATCTGTGGTACTTTGTCATGG + Intergenic
988273774 5:29053794-29053816 CAGTGTTTGATTCTTGGTCAGGG + Intergenic
988399374 5:30742062-30742084 CAGTTTGTGGTACTTTGTTATGG - Intergenic
988580850 5:32467547-32467569 CAGTCTATGGGGCTTTGTTATGG - Intergenic
988660198 5:33258016-33258038 CAGTCTATGGTACTTCGTTATGG + Intergenic
988707620 5:33741209-33741231 CAGTCTGTGGCACTTTGTCATGG - Intronic
989094645 5:37770507-37770529 CAGTCTGTGGTATTTTGTCATGG + Intergenic
989125096 5:38045445-38045467 CAGTCTATGGTACTTTGTTATGG - Intergenic
989254875 5:39355683-39355705 CAGTCTGTGGTACTTTGTTATGG - Intronic
989255535 5:39362557-39362579 CAGCTTGTGGTGCTTTGTTATGG + Intronic
989447525 5:41548055-41548077 CAGTTTGTGGTACTTTGTTATGG - Intergenic
989713842 5:44435380-44435402 CAGTTTGTAGTACTTTGTCATGG - Intergenic
989769852 5:45131104-45131126 CAGACTATGGTACTTGGTTATGG - Intergenic
989785811 5:45327940-45327962 CAGTTTGTGGTATTTTGTCATGG + Intronic
989826719 5:45865391-45865413 CAGTCTGTGGTATTTTGTTATGG - Intergenic
990352882 5:54936606-54936628 CAGTCTGTGGTGCTTTGTTACGG - Intergenic
990460865 5:56029716-56029738 CAGGCTGTGGTACTTTGTTATGG + Intergenic
990585867 5:57210665-57210687 CAGTCTGTGGTATTTGGTTATGG - Intronic
990605734 5:57408054-57408076 CAGTATGTGGTACTTTGTTATGG + Intergenic
990765429 5:59177327-59177349 CAGTCTATGGTACTTTGTTATGG + Intronic
990790044 5:59467207-59467229 CAGTCTGTGGCACTTTGTTATGG + Intronic
990907590 5:60820392-60820414 AAGTCTGTGGTGGTTTGTTATGG + Intronic
990930681 5:61087348-61087370 CAGTCTGTGGTGGTTTGTTATGG + Intronic
991021251 5:61982317-61982339 CAGTCTGTGGTATTTTGTTAGGG + Intergenic
991038260 5:62149938-62149960 CAGTCTGTGGTATTTTGTTATGG - Intergenic
991084979 5:62640479-62640501 CAGTTTGTGGTGCTTTGTTATGG - Intergenic
991125145 5:63061243-63061265 CAGTCTGTAGTGTTTGGTTATGG + Intergenic
991152170 5:63383143-63383165 CAGTTTGTGGTGCTTTGTTATGG + Intergenic
991183121 5:63777636-63777658 CAGTCTGTGGTATTTTGTTAGGG - Intergenic
991218497 5:64184245-64184267 CAGTCTGTGGTACTTTGTTATGG + Intronic
991566659 5:68011932-68011954 CAGTCTGTGGTATTTTGTTATGG - Intergenic
991570059 5:68044466-68044488 CAGTCTGTGGTACTTTGTTAGGG - Intergenic
991592256 5:68265376-68265398 CAGTCTGTGGTGTTTTGTTATGG - Intronic
992155804 5:73954015-73954037 CAGTCTATGGTGCTTTGTTATGG + Intergenic
992255554 5:74917497-74917519 CAGTCTGTGGTACTTTGTTATGG - Intergenic
992304595 5:75423032-75423054 CAGTCTGTGGTACTTTGATATGG + Intronic
992346934 5:75888857-75888879 CAGTCTGTGACGCTTTGTTAAGG - Intergenic
992382121 5:76248215-76248237 CAGTCTGTGGCACTTTGTTATGG - Intronic
992464237 5:76987991-76988013 CAGTTTGTGGTGCTTTGTTGCGG + Intergenic
992583004 5:78201173-78201195 CAATCTGTGGTATTTTGTCATGG + Intronic
992908387 5:81370763-81370785 CAGTCTGTGGTGCTTTGTTACGG + Intronic
993106483 5:83606258-83606280 CAGTTTGTGGTTATTTGTCATGG + Intergenic
993153326 5:84188890-84188912 CAGTCTGTGGTATTTTGTAATGG + Intronic
993374567 5:87135224-87135246 CAGTCTATGGTGCTTTATTATGG - Intergenic
993441429 5:87961690-87961712 CAGTTTGTGGTACTTTGTTATGG - Intergenic
993526489 5:88971910-88971932 CAGTCTATGGTGTTTTGTTATGG + Intergenic
993716868 5:91283529-91283551 CAGTCTGTGGTACTTTGTTATGG - Intergenic
994156878 5:96513772-96513794 CAGTTTGTGGTACTTTGTTATGG - Intergenic
994541660 5:101107417-101107439 CAGTCTGTGGTGTTTTATTATGG - Intergenic
994599592 5:101886328-101886350 CAGTCTGTGGTGCTTTGTTATGG - Intergenic
995400808 5:111739059-111739081 CAGTCTGTGGCACTTTGTTATGG + Intronic
995418988 5:111941318-111941340 CAGTCTGTGGTACTTTGTAATGG - Intronic
995573811 5:113508874-113508896 CAGTCTATGGTATTTTGTCATGG + Intergenic
995837085 5:116409760-116409782 CAGTCTGTGGTACTTTGTTATGG + Intronic
995921524 5:117319814-117319836 CAGTTTGTGGTACTTTGTTATGG - Intergenic
996083090 5:119276494-119276516 CAGTCTGTGGTATTTTGTTATGG - Intronic
996233260 5:121092587-121092609 CAGTCTGCGGTGTTTTGTTATGG - Intergenic
996263773 5:121508882-121508904 CAGTCTGTGGTATTTTGTTATGG - Intergenic
996402716 5:123080557-123080579 CAATCTGTGTGGCTTGGTTAGGG + Intergenic
996505724 5:124265907-124265929 CAGTCTGTGGTATTTTGTTATGG - Intergenic
996565298 5:124873999-124874021 CAGTCTGTGGTACTTTGTTACGG + Intergenic
996596522 5:125209390-125209412 CAGTTTGTGGTACTTTGTTATGG + Intergenic
996770526 5:127080896-127080918 CAGTTTGTGGTACTTTGTTAAGG - Intergenic
997032021 5:130141363-130141385 CAGGTTGTTGTCCTTGGTCATGG - Intronic
997429274 5:133826349-133826371 CAGTTTGTGGTCCTTTGTTATGG - Intergenic
998143921 5:139715276-139715298 CAGTCTGTGGTATTTTGTTACGG - Intergenic
998465494 5:142340702-142340724 CAGCCTGTGGTACTTTGTTATGG - Intergenic
998513027 5:142729400-142729422 CAGTCTGTGCTACTTTGTTATGG - Intergenic
998798313 5:145842053-145842075 CAGTCTGTGGTACTTTGTTATGG + Intergenic
998956216 5:147441199-147441221 CAGCCTGTGGTACTTTGTTATGG - Intronic
999070050 5:148734899-148734921 CACTCTGTGGTACTTTGTTATGG + Intergenic
999473502 5:151877115-151877137 CAATCTGTGGTACTTTGTTATGG + Intronic
999595025 5:153193663-153193685 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1000238853 5:159390269-159390291 CAGTCTGTGGTATTTTGTAATGG + Intergenic
1000282549 5:159794549-159794571 CAGTATGTGGTACTTCGTTATGG + Intergenic
1000286060 5:159827051-159827073 CAGTCTGTGGTACTTCATTATGG - Intergenic
1000290999 5:159871346-159871368 GAGTTTGTGGTGCTTTGTTATGG - Intergenic
1000518562 5:162271344-162271366 CACTCAGTTGTGCTTGTTCAGGG - Intergenic
1000820825 5:165981411-165981433 GAGTCTGTGGTACTTTGTTATGG - Intergenic
1000865130 5:166504349-166504371 CAGTTTGTGGTACTTTGTTACGG - Intergenic
1001051851 5:168420169-168420191 CAGTCTGTGGTACGTTGTTATGG - Intronic
1001072809 5:168601433-168601455 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1001079342 5:168655596-168655618 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1001338814 5:170825003-170825025 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1001341711 5:170852863-170852885 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1001553191 5:172619066-172619088 CAGTCTATGGTGTTTTGTTATGG - Intergenic
1001578158 5:172778590-172778612 CAGTCTGTGGCGCTTTGTTACGG - Intergenic
1001657323 5:173361686-173361708 CAGTCTGTGGCACTTTGTTATGG - Intergenic
1001751090 5:174131970-174131992 CAGTTTGTGGTGCCCTGTCACGG + Intronic
1001785039 5:174404727-174404749 CAGTCTGTGGTATTTCGTTATGG + Intergenic
1001876955 5:175209998-175210020 CAGTTTGTGGTGTTTTGTTATGG - Intergenic
1002402471 5:178998843-178998865 CTGTCTGTGGGGCTTTGTTATGG - Intergenic
1002638268 5:180618694-180618716 CAGGCTGGGGTGCCTGATCACGG + Intronic
1002653212 5:180719417-180719439 CAGTCTGTGGTATTTGGTTAAGG + Intergenic
1002834330 6:853195-853217 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1002837017 6:873521-873543 CAGTCTGTGGTACTTTGTCATGG + Intergenic
1002851205 6:997892-997914 CAGTCTGCGGGGCTTTGCCATGG - Intergenic
1002981465 6:2142675-2142697 CAGTCTGTGGTACTTTGTTATGG + Intronic
1003147379 6:3520125-3520147 TAGTCTGCGGTGCTTTGTTATGG + Intergenic
1003254679 6:4464572-4464594 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1003265983 6:4565431-4565453 CAGGCTGGGGTGCCTGGGCATGG - Intergenic
1003435477 6:6084194-6084216 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1003487145 6:6589582-6589604 CAGCCTGTGGTGGTTTGTTATGG - Intronic
1003585072 6:7381460-7381482 CAGTTTGTGGTGTTTTGTTATGG + Intronic
1003598306 6:7494687-7494709 CAGGCTGTGGTACTTTGTTATGG + Intergenic
1003741702 6:8948012-8948034 CGGTCTGTGGTACTTTGTTATGG - Intergenic
1003846761 6:10181956-10181978 CACTCTGTGGTACTTTGTCATGG - Intronic
1003882201 6:10489036-10489058 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1003948512 6:11096629-11096651 CAGTCTCTGGTATTTTGTCATGG - Intronic
1004003024 6:11612995-11613017 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1004026445 6:11824051-11824073 CAATCTCTGGTGCTTTGTTATGG - Intergenic
1004062002 6:12206678-12206700 CAGTCTGTGGTGCTTTGTTATGG + Intergenic
1004220324 6:13741441-13741463 CAGTCTGTGATACCTTGTCAAGG - Intergenic
1004310347 6:14539985-14540007 CAGGCTGTGGTGCTTTGTTAGGG + Intergenic
1004570430 6:16839570-16839592 CAGTCTGTGGTTTTTTGTTATGG - Intergenic
1004606441 6:17199647-17199669 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1004639663 6:17503162-17503184 CTGTCTGTGGTACTTTGTTAGGG - Intronic
1004911376 6:20288342-20288364 CAGTCTGTGGTAGTTTGTTATGG - Intergenic
1004927717 6:20431818-20431840 CAGTCTGTGGTACTTTCTTATGG - Intronic
1005103994 6:22203480-22203502 CAGCCTGTGGTACTTTGTTACGG + Intergenic
1005154482 6:22788806-22788828 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1005304032 6:24496459-24496481 CAGTCTGTGGTACTTTGCTATGG - Intronic
1005330031 6:24741016-24741038 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
1005483568 6:26277584-26277606 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1005559990 6:27030128-27030150 CAGACTGTGGTACTTTGTTATGG - Intergenic
1005579884 6:27223636-27223658 CAATCTGTGGTACTTTGTTATGG - Intergenic
1005599884 6:27415837-27415859 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1005889091 6:30121700-30121722 CAGCCTGTGGTACTTTGTTACGG + Intergenic
1006039324 6:31240927-31240949 CAGTGTGTGGTACTTTGTTATGG - Intergenic
1006048632 6:31321808-31321830 CTGTCTGGGGTGATTGGTCTTGG - Intronic
1006695239 6:35925493-35925515 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1006987895 6:38188907-38188929 CAGGCTCTGGTTCTTGGTGAGGG - Intronic
1007303058 6:40882935-40882957 CAGCCTGTGGTGTTTGGAAATGG - Intergenic
1007526775 6:42502888-42502910 CAGTTTGTGGTACTTTGTGATGG + Intergenic
1007945878 6:45826763-45826785 CAGGCTGTGGGGCTTGGATATGG - Intergenic
1007971320 6:46054885-46054907 CAGTCTGTGTGGTTTTGTCATGG + Intronic
1007977327 6:46114737-46114759 CAGTCTCTGGTACTTTGTTATGG + Intergenic
1008538481 6:52526104-52526126 CAGTTTGTGGTACTTTGTTATGG + Intronic
1008642239 6:53475840-53475862 CAATCTGTGGTGCTTTGTTATGG - Intergenic
1008980523 6:57478375-57478397 CAGACTGGGGTGCTGGGGCATGG + Intronic
1009168627 6:60371328-60371350 CAGACTGGGGTGCTGGGGCATGG + Intergenic
1009286694 6:61827600-61827622 CAGTCTATGGTGTTTTGTTAAGG - Intronic
1009357599 6:62770579-62770601 CAGTTTGTGGTGTTTTGTTATGG + Intergenic
1009358603 6:62786017-62786039 CAATCTGTGGTGTTTTGTTATGG - Intergenic
1009412750 6:63385091-63385113 CAGCCTGTGGTATTTGGTTATGG + Intergenic
1009459500 6:63894910-63894932 CAGTTTGTGGTACTTTGTTATGG + Intronic
1009530199 6:64803414-64803436 AAGTCTGTGCTGATTGGCCATGG + Intronic
1009545753 6:65018178-65018200 CAGTTTGTGGTGCTTTGATATGG - Intronic
1010021551 6:71165462-71165484 CAGTTTCTGGTGCGTGGTAAGGG - Intergenic
1010309707 6:74370589-74370611 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1010860624 6:80905716-80905738 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1010891435 6:81316415-81316437 CAGTCTGTGGTGTTCTTTCAAGG + Intergenic
1011019769 6:82799287-82799309 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1011128215 6:84029408-84029430 CAGTCTGTGGTACATGGTTATGG - Intergenic
1011130124 6:84044138-84044160 CAGTCTGTGGTATTTTGTTATGG - Intronic
1011255829 6:85419924-85419946 CAGTCTGTGGTATTTGGTTATGG - Intergenic
1011470741 6:87705014-87705036 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1011507430 6:88061736-88061758 CAGTTTGTGGTACTTTGTTATGG + Intronic
1011529014 6:88299616-88299638 CAGTTTGTGGTACTTTGTGATGG - Intergenic
1011607626 6:89119571-89119593 AAATCTGTGGTGCTTTGTCATGG - Intergenic
1011709523 6:90038095-90038117 CAGTTTGTGGTACTTTGTTATGG + Intronic
1011859036 6:91732211-91732233 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1012024521 6:93971887-93971909 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1012244446 6:96911087-96911109 CAGTTTGTGGTACTTTGTTACGG - Intergenic
1012249020 6:96959340-96959362 CAGTCTGTGGTACTTTGTTATGG - Intronic
1012457491 6:99423756-99423778 CAGTCTTTGGTACTTTGTTATGG - Intronic
1013223501 6:108101406-108101428 CAGTCTGTGCTACTTTGTTATGG + Intronic
1013263145 6:108466824-108466846 CAGTCTGTGGTATTTTGTTATGG + Intronic
1013559762 6:111292541-111292563 CAGTCTGTGGTGCTTTGTTATGG + Intergenic
1013580251 6:111527006-111527028 CAGTTTGTGGTACTTTGTTACGG - Intergenic
1013593465 6:111640572-111640594 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1013732419 6:113184382-113184404 CAGTCTGTGGTACTTCGTCAAGG - Intergenic
1013756163 6:113464340-113464362 CAGTCTGTGATACTTGGTTATGG - Intergenic
1013865358 6:114690072-114690094 CAGTCTATGGTACTTTGTTATGG - Intergenic
1014000680 6:116362658-116362680 CAGTCTATGGTATTTTGTCATGG + Intronic
1014254816 6:119150390-119150412 CAGTTGGTGGTGCTTTGTTATGG + Intergenic
1014760321 6:125349019-125349041 CAGTTTGTGATCCTTTGTCATGG + Intergenic
1015298759 6:131629159-131629181 CAGTCTGTGGTATTTTGTTATGG - Intronic
1015300726 6:131650573-131650595 CAGTCTGTGGTACTTTGTCATGG - Intronic
1015640543 6:135327152-135327174 CAGTCTGTGGTATTTTGTTAGGG + Intronic
1015832660 6:137386970-137386992 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1015975454 6:138786005-138786027 CAGTCTGTGGTACTTTGTTTTGG - Intronic
1015978161 6:138812266-138812288 CAGTCTGTGGTAGTTTGTTATGG + Intronic
1016475644 6:144424151-144424173 CAGCTTGTGGTACTTGGTTACGG - Intronic
1016586963 6:145699025-145699047 CAGTCTGTGGTATTTTGTTATGG + Intronic
1016601613 6:145867979-145868001 CAGTTTGTGGTACTTTGTTATGG - Intronic
1016602369 6:145877019-145877041 CAGTCTGTGGTATTTTGTTATGG + Intronic
1016758051 6:147708424-147708446 CAGTCTGTGGTACTGTGTTATGG + Intronic
1016852646 6:148636699-148636721 CAGTCTGTGGCACTTTGTTATGG + Intergenic
1016939927 6:149475208-149475230 CAGTCTGTGGTGCTTTGCTCTGG + Intronic
1017066442 6:150533487-150533509 CAGTCTGTGGTACTGGGTTGTGG + Intergenic
1017273339 6:152535271-152535293 CAGTATGTGGTACTTTGTTACGG + Intronic
1017332245 6:153213401-153213423 CACTCTGTGGTATTTGGTTATGG - Intergenic
1017343079 6:153348603-153348625 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1017364693 6:153621599-153621621 CAGGCTGTGGTACTTTGTTACGG - Intergenic
1017433093 6:154390687-154390709 CAGTCTGTGGTATTTTGTTATGG - Exonic
1017448071 6:154527230-154527252 CAGCTTGTGGTACTTTGTCATGG + Intergenic
1017602434 6:156098249-156098271 CAGTCTGTGGTACCTTGTTATGG + Intergenic
1017845935 6:158258345-158258367 CAGTCTCTGCTGTTTGGTCCAGG + Intronic
1017917880 6:158846740-158846762 TGGTCTGTGGTACTTTGTCACGG - Intergenic
1017942106 6:159061944-159061966 CAGTCTGTGGTCCCTTGTAATGG + Intergenic
1018269623 6:162062737-162062759 CAGTCTGGGGTATTTTGTCATGG + Intronic
1018383327 6:163280550-163280572 CAGTCTCTGGTGTTTGGCTATGG - Intronic
1018391218 6:163343308-163343330 CAGCCTGTGCTGCTAGGTCTGGG - Intergenic
1018682834 6:166278054-166278076 CTGTCTGTGGCACTTGGTTATGG + Intergenic
1018890766 6:167979923-167979945 CAGTCTGTGGTGCTTTGTTCTGG - Intergenic
1019089261 6:169513140-169513162 CACCCTGTGGTGCTTGGTTGGGG + Intronic
1019206804 6:170368705-170368727 CAGTCCGTGGTGTTTTGTTATGG - Intronic
1019332920 7:469768-469790 CAGTCTGTGGTGCTTTGTCACGG - Intergenic
1019363634 7:619015-619037 CAGTCTGTGGTGCTCTGTGATGG - Intronic
1019515583 7:1438498-1438520 GTGTCTGTGGGGCTGGGTCAGGG - Intronic
1019606992 7:1914930-1914952 CAGTCAGTGCTGGTTTGTCATGG + Intronic
1019730786 7:2628262-2628284 CAGTTTGTGGAGCTTTGTCACGG - Intergenic
1019747018 7:2706421-2706443 CAGTTTGTGGTACTTTGTTACGG - Intronic
1020529733 7:9317942-9317964 CAGTTTGTAGTGCTTTGTTAAGG - Intergenic
1020569249 7:9837626-9837648 AAGTTTGTGGTCCTTTGTCATGG + Intergenic
1020736323 7:11953578-11953600 CATTCTGTGGTACTTTGTTAAGG - Intergenic
1020737816 7:11973615-11973637 CAGTCTTTGGTGTTTCTTCATGG - Intergenic
1021190138 7:17610794-17610816 GAGTCTGTGGTACTTTGTTATGG + Intergenic
1021233784 7:18117792-18117814 CAGTCTGTGGTACTTTGTTACGG + Intronic
1021425432 7:20494867-20494889 CAGTCTATGGTCCTTTGTTATGG + Intergenic
1021427761 7:20522070-20522092 AAGTCTGTGGTTCTTTTTCATGG + Intergenic
1021444421 7:20717237-20717259 TAGTCTGTGGTCCTTTGTTATGG - Intronic
1021538571 7:21732113-21732135 CAGTCTGTGGTATTTTGTTATGG - Intronic
1021567288 7:22028244-22028266 CAGTCTATGGTGTTTTGTTACGG + Intergenic
1021617975 7:22522002-22522024 CTGTCTGTGGTACTTGGTGGTGG + Intronic
1021667702 7:23002773-23002795 CAGTCTGTGGTACTTTGTTACGG - Intronic
1021689985 7:23222301-23222323 CAGTCTGTGCTACTTTGTTATGG + Intergenic
1021734490 7:23629448-23629470 TAGTCTGTGGTGTTTTGTGATGG + Intronic
1021899967 7:25275468-25275490 CAGGTTGTGGTACTTGGTTATGG - Intergenic
1022199300 7:28100817-28100839 AAGTCTGTGGTAGGTGGTCATGG + Intronic
1022387928 7:29918765-29918787 CAGTTTGTGGTACTTTGTGACGG + Intergenic
1022561534 7:31354675-31354697 CAGTCTGTGATGTTTAGTTATGG - Intergenic
1022657688 7:32335428-32335450 CAGTCTGTGGTACTTTGCTATGG - Intergenic
1022927563 7:35071482-35071504 CTGTCTGTGGTACTTGATGATGG + Intergenic
1022960647 7:35423240-35423262 CAGTCAGTGGTACTTTGTTATGG - Intergenic
1023156234 7:37255438-37255460 CAGTCTGTGGTATTTTGTTATGG + Intronic
1023166826 7:37350999-37351021 CAGTCTGTGGTACTTTTTTATGG + Intronic
1023226655 7:37976538-37976560 CAGACTGTGGTACTTTGTAATGG + Intronic
1023597340 7:41845049-41845071 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1024007396 7:45236799-45236821 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1024241222 7:47438286-47438308 CTGTCTGTGGGGCCTTGTCAGGG - Intronic
1024352843 7:48384713-48384735 CAGTTTGTGGTACTTTGTTATGG - Intronic
1024377125 7:48652682-48652704 CAGGCTGTGGTACTTTGTTACGG - Intergenic
1024414004 7:49081333-49081355 CAGTCTGTGGAACTTTGTTATGG - Intergenic
1024414190 7:49083123-49083145 CAGTATGTGGTACTTTGTTATGG - Intergenic
1024534845 7:50421524-50421546 GAGACTGTGGTGCTCGGTGAAGG + Intergenic
1024804859 7:53126930-53126952 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1025289861 7:57707363-57707385 CAGTCTGTGGTATTTTGTGATGG + Intergenic
1025307406 7:57874706-57874728 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1025481273 7:60986455-60986477 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1025838302 7:65117737-65117759 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1025878974 7:65515345-65515367 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1025884771 7:65578240-65578262 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1027863098 7:83610889-83610911 CCCTCTGTGGTACTTGGTTATGG + Intronic
1028000607 7:85493318-85493340 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1028101907 7:86831113-86831135 CAGTTTGTGGTACTTCGTTATGG + Intronic
1028211973 7:88084788-88084810 CAGTCTGTGGTACTTTGTTATGG - Intronic
1028322075 7:89472738-89472760 AAGTCTGTGGTACTTTGTTATGG + Intergenic
1028374709 7:90134106-90134128 CTGTCTGTGGTACTTGGTGATGG - Intergenic
1028411333 7:90533514-90533536 CAGTCCGTGGTACTTTGTTATGG - Intronic
1028448728 7:90955848-90955870 CTATCTGTAGTGCTTGGTCTGGG + Intronic
1028512081 7:91636322-91636344 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1028651415 7:93154089-93154111 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1028860989 7:95650200-95650222 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1028954081 7:96669139-96669161 CAGTCTGTGGTACTTTGTTATGG + Intronic
1029986625 7:104928681-104928703 CAGTCGGTGGTTCTTTGTTAAGG + Intergenic
1030174214 7:106633627-106633649 CAGTGTGTGGTACTTTGTTATGG + Intergenic
1030214698 7:107032361-107032383 CAGTCTATGGTGCTTTGTTATGG + Intergenic
1030472727 7:109986947-109986969 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1030635143 7:111939675-111939697 CAGTTTGTGGTACTTGGTTAGGG + Intronic
1030650035 7:112107559-112107581 CAGTCTGTGGTATTTTGTTATGG + Intronic
1030914591 7:115296677-115296699 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1030980402 7:116179383-116179405 CAGTCTGTGGTACTTCATTATGG - Intergenic
1031380407 7:121078833-121078855 CAGTCTGTGGTACTTTGTTACGG - Intronic
1031471047 7:122169755-122169777 CAGTCTGTGGTATTTCGTTATGG - Intergenic
1031553865 7:123147695-123147717 TAGTCTGTGGTGTTTTGTTATGG + Intronic
1031656038 7:124356783-124356805 CAGTCTGTGGCGCTTTGTCATGG + Intergenic
1031700560 7:124919767-124919789 CAATCTGTGGTACTTTGTTATGG + Intronic
1031824169 7:126542185-126542207 CAGTCTGTGGTACTTTGTTATGG + Intronic
1031870908 7:127089412-127089434 CAGTGTGTGGTGATTTGTTAAGG + Intronic
1031922802 7:127613898-127613920 CAGTTTGTGGTGGTTTGTGATGG + Intronic
1032877636 7:136054644-136054666 CAGTCTGTGATGTTTTGTTATGG - Intergenic
1033003555 7:137535109-137535131 CACTCTGTGGTACTTTGTTATGG + Intronic
1033046505 7:137967257-137967279 CAGTCTATGGTACTTTGTTAAGG + Intronic
1033753553 7:144378947-144378969 CAGTCCATGGTACTTTGTCATGG - Intronic
1034104335 7:148477470-148477492 CAGTCTGTGGTCCTTTGTTATGG + Intergenic
1034122426 7:148639815-148639837 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1034572019 7:151963975-151963997 CAGTCTGTTGGACTTGGTTATGG - Intronic
1034859452 7:154583170-154583192 CAGTCTGTGGTATTTTGCCATGG - Intronic
1034919464 7:155068049-155068071 CAGTCTGTGGTATTTTGTTATGG - Exonic
1034945050 7:155256484-155256506 CAGTCTGTGGTATTTTGCCACGG + Intergenic
1035526222 8:315371-315393 CAGTCTATGGTGCTTTGTTATGG - Intergenic
1035576753 8:712949-712971 CAGTCTGTGGGGCTTTGTAGTGG - Intronic
1035993294 8:4516360-4516382 CAGTTTGTGGTACTTTATCATGG + Intronic
1036009774 8:4709039-4709061 CAGTCTATGGTACTTTGTTATGG + Intronic
1036081257 8:5558584-5558606 CAGTCTGTGGTAATTTGTTATGG - Intergenic
1036627268 8:10482716-10482738 CAGTCTATGGTGTTTTGTAACGG - Intergenic
1037393776 8:18420942-18420964 CAGCCTGTGGTGCTTTGTTGTGG + Intergenic
1037454374 8:19048818-19048840 CAGTCTGTGGTGTTTTGTTATGG - Intronic
1037677589 8:21065068-21065090 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1038285299 8:26200995-26201017 CAGTCTGTGGTCCTTTATTATGG + Intergenic
1038433648 8:27519676-27519698 TAGTCTGTGGCGCTTTGTTACGG - Intronic
1038486327 8:27937620-27937642 CAGTCTGTGGTATTTTGTGATGG - Intronic
1038521977 8:28241757-28241779 CAGTATGTGGTACTTTGTGATGG + Intergenic
1038524514 8:28261559-28261581 CAGTCTGTGGTACTTTGTGATGG + Intergenic
1039083539 8:33757555-33757577 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1039208736 8:35187020-35187042 CAGTCTGTCGTGTTTTGTTATGG - Intergenic
1039381890 8:37093210-37093232 CAGTTTATGGTGCTTAGTGAAGG - Intergenic
1039389061 8:37162537-37162559 CAGTCTGTGGTGCTCTGTTATGG - Intergenic
1040864754 8:52037838-52037860 CAGTCTGTGCTACTTCGTTATGG - Intergenic
1040980917 8:53245480-53245502 CAGTCTGCGGTGCTTTGTTATGG + Intronic
1041077983 8:54186574-54186596 CAGTCTGTGGCACTTTGTTATGG + Intergenic
1041427791 8:57742364-57742386 TAGTCTGTGGTGTTTGGTTATGG - Intergenic
1041621253 8:59972249-59972271 CAGTCTGTTGTGCTTTGTTATGG - Intergenic
1041660115 8:60393054-60393076 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1041684479 8:60630522-60630544 CAGTCTGTTGTACTTTGTCATGG - Intergenic
1041709155 8:60877027-60877049 CAGTCTGTGGTACCTGGTTATGG + Intergenic
1041726886 8:61026398-61026420 CAGTCTGTGACGCTTTGTTATGG + Intergenic
1041734436 8:61094859-61094881 CGATCAGTGGTGCTTGGTCTTGG + Intronic
1041746670 8:61214666-61214688 CAGTTTGTGGTGATTTGTTATGG + Intronic
1041941931 8:63398218-63398240 CAGTCTGTGGTACTTTGTTCTGG + Intergenic
1042168472 8:65970105-65970127 CAGTCTGTGGTACCTGGTTATGG + Intergenic
1042271234 8:66957610-66957632 CAGTCTGTGGTATTTTGTTATGG + Intronic
1042309470 8:67366084-67366106 CAGTCTATGGTACTTTGACATGG - Intergenic
1042324374 8:67513572-67513594 AAGTCTGTGGTACTTTGTTATGG + Intronic
1042449776 8:68930932-68930954 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1042928967 8:73994812-73994834 CAGTCTGTGGTATTTTGTTATGG - Intronic
1043197170 8:77310574-77310596 TAGTGTGTGGTACTTGGTTATGG - Intergenic
1043220588 8:77657411-77657433 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1043392787 8:79807756-79807778 CAGCCTGTGGTCCTTTGTGATGG + Intergenic
1043402286 8:79895635-79895657 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1043788610 8:84434012-84434034 CAGTCTGTAGTACTTTGTTATGG - Intronic
1043950216 8:86300344-86300366 CAGTCTGTGATACTTAGTTATGG + Intronic
1043957916 8:86383917-86383939 CAGTCTGTGGTATTTTGTTATGG - Intronic
1044167386 8:89003446-89003468 CAGTCTGTGGAGCTTTGTTTTGG + Intergenic
1044191134 8:89319175-89319197 CAGTCTGTGGTACTTTGCCATGG - Intergenic
1044278364 8:90328206-90328228 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1044774112 8:95669808-95669830 CAGTCAGTGGTACTTTGTTATGG - Intergenic
1044827116 8:96209210-96209232 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1044933514 8:97272463-97272485 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1045191882 8:99891703-99891725 CAGTCTGTGGTTCTTTGTTACGG + Intronic
1045219688 8:100186662-100186684 CAGTCTGTGGTACTTTGTTACGG - Intronic
1045554498 8:103202504-103202526 CAGTCTGTGGTACTTTGTTATGG + Intronic
1045731692 8:105248818-105248840 CAGTCTGTGGTATTTTGTTATGG + Intronic
1045929518 8:107605644-107605666 CAATCTGTGGTGCATAGGCACGG - Intergenic
1045986697 8:108257366-108257388 CAGTCTGTGGTAGTTGGTTATGG + Intronic
1046046775 8:108974185-108974207 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
1046194335 8:110839127-110839149 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1046327238 8:112664900-112664922 CAGTCTGTGACACTTGGTTATGG + Intronic
1046427728 8:114077315-114077337 CAGTCTGTGGTGTTTTGTTATGG + Intergenic
1046627199 8:116587732-116587754 CAGTCTGCGGTACTTTGTCATGG - Intergenic
1046673289 8:117081242-117081264 CAGTCTGTGGTGTTTTGTTATGG - Intronic
1046852656 8:118993155-118993177 CAATCTGTGGTACTTTGTTAAGG - Intergenic
1046858697 8:119066028-119066050 CAGTTTGTGGTGCTTTGTTATGG + Intronic
1046999139 8:120556013-120556035 CAGTCTGTGGTATTTTGTTATGG + Intronic
1047027109 8:120836145-120836167 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1047042817 8:121016830-121016852 CAGTGGGTTGTGCTTGGTTAGGG + Intergenic
1047224534 8:122945136-122945158 CAGTCTGTGGCATTTTGTCATGG + Intronic
1047462941 8:125086132-125086154 CTCTCTGTGGTGCTTTGTTACGG - Intronic
1047549808 8:125858085-125858107 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1047807141 8:128372335-128372357 CAGTCTGTGTTGTTTTGTCATGG - Intergenic
1047889465 8:129291735-129291757 CAGTCTGTGGTGCTCTGTTAGGG + Intergenic
1048193554 8:132312206-132312228 CAGGTTGTGGTGCTTTGTTATGG + Intronic
1048259197 8:132931310-132931332 CATTCTGTGGTGCTTGGGGAAGG + Intronic
1048314359 8:133351132-133351154 CAGTCTGTGGTATTTGTTTATGG - Intergenic
1048393921 8:133994862-133994884 CAGCCTGTAGTACTTTGTCATGG + Intergenic
1048835684 8:138516793-138516815 CAGTCTGTGGTATTTGGTTATGG - Intergenic
1048945988 8:139447796-139447818 CAGTCTGTGGTATTTGGTTATGG - Intergenic
1049020530 8:139954533-139954555 CAGTCTGTGGTACTTTGTTACGG + Intronic
1049285307 8:141771760-141771782 CAGTCTGTGGCACTTTGCCATGG - Intergenic
1049297577 8:141851000-141851022 CAGCCTGTGGTGCTTGATGATGG + Intergenic
1049406846 8:142455396-142455418 CCCTCTCTGGGGCTTGGTCAGGG + Intronic
1049712041 8:144069261-144069283 AAGTCTGTGGTGATTTGTGAGGG - Intergenic
1049744248 8:144256458-144256480 CAGCCTGTGGTGCTGGGGCAGGG - Intronic
1050185252 9:2966137-2966159 CACCCTGTGGTACTTGGTTATGG + Intergenic
1050231915 9:3535383-3535405 CAGTCTGTAGTGTTTTGTTATGG - Intergenic
1050272454 9:3960360-3960382 CAGTTTGTGGTACTTTGTTATGG + Intronic
1050417113 9:5429391-5429413 CAGTTTGTGGTCCTTTGTTATGG - Intronic
1050683873 9:8145485-8145507 CAGTTTGTGGTACTTTGTGATGG + Intergenic
1051063402 9:13072436-13072458 CAATCTGTGGTACTTGGTTATGG - Intergenic
1051472357 9:17459581-17459603 CAGTCTGTGGTATTTTGTTACGG - Intronic
1051506228 9:17830571-17830593 CACTCTGTGATACTTGGACATGG - Intergenic
1051650426 9:19318557-19318579 TAGTCTGTGGTACTTTGTTATGG - Intronic
1051686081 9:19659375-19659397 CAGTTTGTGGTACTTTGTTATGG + Intronic
1051747130 9:20305790-20305812 CAGTCTATGGTACTTTGTTAAGG - Intergenic
1052165869 9:25327211-25327233 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1052561055 9:30084514-30084536 CAGTCTGTGGTATTTTGTAAGGG - Intergenic
1053265627 9:36711165-36711187 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1053348762 9:37397601-37397623 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1053406097 9:37877351-37877373 CAGTCTATGGTACTTTGTTATGG + Intronic
1053577991 9:39372220-39372242 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1053583677 9:39434176-39434198 CAATCTGTGGTACTTTGTGATGG + Intergenic
1053698062 9:40657048-40657070 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1053842518 9:42200279-42200301 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1053944071 9:43287256-43287278 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1054099575 9:60931005-60931027 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1054105257 9:60992919-60992941 CAATCTGTGGTACTTTGTGATGG + Intergenic
1054120972 9:61206629-61206651 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1054309353 9:63456456-63456478 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1054357186 9:64072092-64072114 CTATCTGTGCTGCTTGTTCAGGG - Intergenic
1054408149 9:64780578-64780600 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1054441295 9:65264404-65264426 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1054488982 9:65757085-65757107 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1054586766 9:66975878-66975900 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1054764125 9:69028869-69028891 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1054812626 9:69446937-69446959 TAGTCTGTGGTACTTTGTCATGG - Intronic
1055505267 9:76941852-76941874 CAGTCTGTGGTGTTTTGTTACGG + Intergenic
1055573983 9:77644642-77644664 CAGTCTGTGGTATTTTGTTATGG + Intronic
1055623108 9:78146373-78146395 CAGTCTGTGATACTTTGTTATGG - Intergenic
1055664384 9:78538876-78538898 CAGTCTGTTGTGCTTTATTATGG + Intergenic
1055690439 9:78824298-78824320 CAGTCTATGGTGTTTTGTTATGG - Intergenic
1055742477 9:79405073-79405095 CTGTTTGTGGTGCTTTGTTATGG - Intergenic
1056037587 9:82623480-82623502 CAGTCTGTGGTACTTTGCTATGG + Intergenic
1056184639 9:84121501-84121523 CAGTCTGTGGTATTTTGTTACGG + Intergenic
1056190139 9:84176812-84176834 CAGTCTGAGGTACTTTGTTATGG - Intergenic
1056329135 9:85507526-85507548 CAGTCTGCAGTACTTTGTCATGG + Intergenic
1056388789 9:86121331-86121353 CAGTCTGTAGTACTTTGTTATGG - Intergenic
1056737358 9:89221051-89221073 ATGTCTGTGGTGCTTTGTCATGG + Intergenic
1056958751 9:91103426-91103448 CAGTCTATAGTACTTTGTCATGG + Intergenic
1057052507 9:91936244-91936266 CAGTTTGTGGTGCTTAGTTACGG - Intronic
1057085271 9:92204223-92204245 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1057151633 9:92801071-92801093 CACTCTGTGGTACTTTGTTAAGG - Intergenic
1057159133 9:92873331-92873353 CAGTCTATGGTACTTTGTTATGG + Intronic
1057212950 9:93210404-93210426 CAGGCTGTGGAGTTGGGTCAGGG + Intronic
1057268176 9:93632420-93632442 CAGTCTGTGGTATTTTGTTACGG - Intronic
1057282612 9:93723616-93723638 CAGTTTGTGGTACTTTGTCATGG - Intergenic
1057308757 9:93928205-93928227 CAGTCCGTGGTGCTTCATGATGG - Intergenic
1057331956 9:94123091-94123113 TAGTCTGTGGTACTTTGTTATGG + Intergenic
1057368885 9:94451831-94451853 CAGGCTGGGCTGCCTGGTCAAGG - Intronic
1057393178 9:94656012-94656034 CGATTTGTGGTGCTTGGTTATGG + Intergenic
1057430087 9:94986045-94986067 CAGTCTGTGGTACTTAGTTATGG - Intronic
1057521600 9:95764753-95764775 CAGTCTGTGGGACTTTGTTATGG + Intergenic
1058045934 9:100356599-100356621 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1058395770 9:104552329-104552351 GAGTTTGTGGTACTTTGTCATGG - Intergenic
1058585510 9:106502527-106502549 CAGGCTCTGGTGATTGTTCATGG + Intergenic
1058638322 9:107058220-107058242 CAGTCTATGGTGCTGTGTCCTGG - Intergenic
1058662164 9:107276385-107276407 CAATCTGTGGTACTTTGTTATGG + Intergenic
1058933781 9:109748713-109748735 CAGTCTCTGGTACTTTGTTATGG - Intronic
1059179436 9:112197991-112198013 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1059497239 9:114719990-114720012 CAGTCTGTGGTACTTTTTTATGG + Intergenic
1059498815 9:114732844-114732866 CAGTCTGTGGCACTTTGTTACGG + Intergenic
1059888851 9:118778536-118778558 CAGTTTGTGCTGCTTTGTTATGG - Intergenic
1059909157 9:119023226-119023248 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1059991657 9:119870965-119870987 CAGTCTATGGTATTTTGTCATGG - Intergenic
1060045296 9:120335726-120335748 CAGCCTGTGGTACTTTGTTATGG - Intergenic
1060303122 9:122387722-122387744 CATTCTGTGGTACATTGTCATGG + Intronic
1060748352 9:126152517-126152539 GAGTCTGTGATGCTGGTTCATGG + Intergenic
1060767623 9:126306869-126306891 CAGTCTGCGGTCCTTTGTCATGG - Intergenic
1061322694 9:129841118-129841140 CAGTCTGTGGTACTTTGTTATGG - Intronic
1061614083 9:131767969-131767991 TAGTCTGTGGTCCTTTGTTATGG - Intergenic
1061799981 9:133108576-133108598 CAGGGTCTGGTGCTGGGTCAGGG - Intronic
1062443592 9:136584202-136584224 CAGTCTGTGGTACTTCGTTACGG + Intergenic
1062481221 9:136753428-136753450 CAGTCTGGGGTATTTTGTCACGG + Intergenic
1202780426 9_KI270717v1_random:30238-30260 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1203582098 Un_KI270746v1:17768-17790 CAGTTTGTGTTACTTGGTTATGG + Intergenic
1203587206 Un_KI270747v1:15834-15856 CAGTTTGTGTTACTTGGTTATGG - Intergenic
1185663674 X:1746889-1746911 CAGTCTGTGGTGATTTGTTATGG + Intergenic
1185779634 X:2833059-2833081 CAGTCTGTGGGACTTTGTTATGG - Intronic
1185800642 X:3007476-3007498 CAGTCTGTGGACCTTTGTCACGG - Intronic
1185845133 X:3430767-3430789 CAGTCTGTGGCTCTTTGTCATGG + Intergenic
1185880347 X:3734671-3734693 CAGCCTGTGGTACTTGGTGAAGG + Intergenic
1185882068 X:3750450-3750472 CATTCTGTGGTCCTTGACCAAGG + Intergenic
1185924697 X:4133256-4133278 CAGGCTGTGGTCCTTTGTTATGG - Intergenic
1185927432 X:4162822-4162844 CAGTGTGTGGTACTTTGTTACGG + Intergenic
1186009747 X:5116275-5116297 CAGTCTGTGGGACTTTGTTATGG - Intergenic
1186009812 X:5116749-5116771 CAGTCTGTGGGACTTTGTTACGG + Intergenic
1186012616 X:5151797-5151819 CAGGCTGTGGTACTTTGTTATGG + Intergenic
1186129230 X:6448444-6448466 CAGTCTGTCGTACTTTGTTATGG - Intergenic
1186155289 X:6719096-6719118 CCGTCTGTGGTAGTTTGTCATGG - Intergenic
1186366160 X:8895841-8895863 CAGTTTGTGGTGCTTTGTTATGG + Intergenic
1186513690 X:10150165-10150187 CAGTCTGTGGGACTTGGTTACGG - Intergenic
1186515969 X:10166349-10166371 CAGTCCGTGGTGCTTGGTTACGG + Intronic
1186651992 X:11571150-11571172 CAGTCTGTGGTATTTTGTAATGG + Intronic
1186850550 X:13575595-13575617 CAGTCTGTGGTACTTTGTTATGG + Intronic
1186909250 X:14143962-14143984 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1186945580 X:14562535-14562557 CAGTCTGTGGTATTTTGTTATGG - Intronic
1187009289 X:15263992-15264014 CAGTTTGTGGTGTTTCGTTATGG - Intronic
1187042442 X:15610934-15610956 CCATCAGTGGAGCTTGGTCAAGG + Intergenic
1187104341 X:16224610-16224632 TAGTGGGAGGTGCTTGGTCATGG - Intergenic
1187329177 X:18320169-18320191 CAGTCTGTGGTACTTTGTTATGG + Intronic
1187436163 X:19271924-19271946 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1187608616 X:20915390-20915412 CAGTCTATGGTACTTTGTTATGG - Intergenic
1187630236 X:21161339-21161361 CAGACTGTGGTACTTTGTTATGG - Intergenic
1188189078 X:27152212-27152234 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1188576397 X:31655845-31655867 CAGTCTGTGGTATTTTGTTACGG + Intronic
1188774880 X:34203732-34203754 CAGTTTGTGGTGCTTTATTATGG - Intergenic
1188814832 X:34699758-34699780 CAGTCTGTGGTTTTTTGTTATGG - Intergenic
1188846780 X:35082285-35082307 CAGTCTGTGATACTTTGTTATGG + Intergenic
1189193111 X:39128621-39128643 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1189343591 X:40223247-40223269 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1189371100 X:40430130-40430152 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1189478358 X:41374626-41374648 CAGTCTGTGGCATTTGGTTATGG + Intergenic
1189539592 X:41972047-41972069 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1189563298 X:42213373-42213395 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1189605603 X:42674494-42674516 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1189744013 X:44151216-44151238 CAGTCTGTGGTACTTTGTGAGGG + Intronic
1189857744 X:45240293-45240315 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1190009733 X:46774275-46774297 CAGTCTTTGGTATTTGGTTATGG - Intergenic
1190018456 X:46850054-46850076 CAGTCTGTGGTATTTTGTTATGG - Intronic
1190034704 X:47010740-47010762 CAGTCTGTGGTATTTTGTTATGG - Intronic
1190074520 X:47306639-47306661 CAGTCTATGGTATTTCGTCATGG + Intergenic
1190104919 X:47553035-47553057 CAGTCTGTGGTATTTAGTTATGG - Intergenic
1191776725 X:64822559-64822581 CAGTCTGTGGTACTTTTTTATGG + Intergenic
1193170936 X:78334623-78334645 CTGTCTGTATTGCCTGGTCAAGG + Intergenic
1193454734 X:81716928-81716950 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1193825551 X:86221761-86221783 CAGTCTGTGGTGCTTTGTTAAGG - Intronic
1193898923 X:87151108-87151130 TAGTCAGTTCTGCTTGGTCATGG + Intergenic
1193927204 X:87501822-87501844 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1194043146 X:88968901-88968923 CAATCTGTGGTGTTTAGTTATGG - Intergenic
1194335088 X:92636325-92636347 TAGTCTGTGGTGTTTTGTGATGG - Intergenic
1194344240 X:92743496-92743518 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1194649293 X:96496662-96496684 CAGTCTATGGTACTTGGGTATGG + Intergenic
1194795387 X:98205534-98205556 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1194995168 X:100584020-100584042 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1195062258 X:101207665-101207687 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1195136499 X:101912039-101912061 AATTCTCTGGTGCTTGGTAAGGG - Intronic
1195482261 X:105359191-105359213 AATGCTCTGGTGCTTGGTCAAGG - Intronic
1195612836 X:106888344-106888366 CAGTCTGTGGTATTTTGTTATGG + Intronic
1195907541 X:109860117-109860139 CAGTCTGTGGTACTTTGTTATGG + Intergenic
1196415995 X:115471762-115471784 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1196608661 X:117685679-117685701 CAGTCTGTGGTCCCTGGGCTGGG - Intergenic
1196980118 X:121203653-121203675 CAGGTTGTCGTCCTTGGTCATGG + Intergenic
1197176905 X:123495734-123495756 CAGTCTGTGGTATTTTGTTATGG + Intergenic
1197346382 X:125328377-125328399 CAGTCTGTGGTACTTTGTTAAGG - Intergenic
1197454272 X:126658344-126658366 CAGTTTGTGGTACTTTGTTAAGG + Intergenic
1197548404 X:127856658-127856680 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1197780453 X:130153879-130153901 CAGTCCGTGGTGTTTTGTTATGG + Intronic
1197818986 X:130527624-130527646 CAGTTTGCGGTACTTTGTCATGG - Intergenic
1197885079 X:131209977-131209999 CAGTTTGTGGTACTTTGTTATGG + Intergenic
1198073349 X:133170968-133170990 CAGTCTGTGGTACTTTGTTATGG - Intergenic
1198078800 X:133219308-133219330 CAGTCTATGGTGTTTTGTTACGG - Intergenic
1198206130 X:134466600-134466622 CAGTCTGTGGTATTTTGTTATGG + Intronic
1198263049 X:134983585-134983607 CTGTCTGTGGTACTTTGTTATGG - Intergenic
1198483194 X:137059885-137059907 CAGTGTGTGGTACTTTGTTATGG - Intergenic
1198803782 X:140473984-140474006 CAGTTTGTGGTACTTTGTTATGG - Intergenic
1198952986 X:142093978-142094000 CAGTTTGTGGTACTTTGTTAGGG + Intergenic
1199009389 X:142740843-142740865 CAGTCTGTGGTATTTTGTTATGG - Intergenic
1199417274 X:147599662-147599684 CAGTCTGTGGTACTTCTTTATGG + Intergenic
1199489827 X:148386118-148386140 CAATCTGTGGTGCTTTGTTATGG + Intergenic
1199570339 X:149261210-149261232 CAGCCTGTGGTACTTTGTCAGGG - Intergenic
1199741219 X:150738457-150738479 CAGTCTGTGGTACCTTGTTATGG - Intronic
1199936164 X:152575695-152575717 CAGTCTGTGGTACTTCGTTATGG - Intergenic
1199964933 X:152811899-152811921 CAGTCTGTGATGCTTTGTCATGG + Intergenic
1200139746 X:153893840-153893862 CAGTCTGTGGTATTTTGTGATGG + Intronic
1200251610 X:154557140-154557162 CAGTCTGTGGTGCTTGGTCACGG - Intronic
1200253817 X:154568824-154568846 CAGTCTGTGGTGCTTGGTCACGG - Intergenic
1200263952 X:154635584-154635606 CAGTCTGTGGTGCTTGGTCACGG + Intergenic
1200266157 X:154647276-154647298 CAGTCTGTGGTGCTTGGTCACGG + Intergenic
1200501144 Y:3951307-3951329 CAGTCTGTGATGTTTTGTTATGG + Intergenic
1200643560 Y:5753378-5753400 TAGTCTGTGGTGTTTTGTGATGG - Intergenic
1200652590 Y:5860145-5860167 TAGTCTGTGGTACTTTGTTATGG - Intergenic
1200781967 Y:7224889-7224911 CAGCCTGCTGTGCTTGATCAAGG - Intergenic
1200782905 Y:7232756-7232778 CATTCTGTGGTCCTTGACCAAGG - Intergenic
1200807723 Y:7449299-7449321 CAGTCTGTGGACCTTTGTTATGG + Intergenic
1200819156 Y:7564320-7564342 CAGTCTGTGACTCTTTGTCATGG - Intergenic
1201242689 Y:11973892-11973914 CAGTTAGTGGTACTTTGTCATGG - Intergenic
1201290406 Y:12416934-12416956 CAGTCTGTGGGACTTTGTTATGG + Intergenic
1202302485 Y:23431973-23431995 CACTCTGTGATGTTTGCTCAGGG - Intergenic
1202568326 Y:26238621-26238643 CACTCTGTGATGTTTGCTCAGGG + Intergenic