ID: 1200251614

View in Genome Browser
Species Human (GRCh38)
Location X:154557146-154557168
Sequence GCCCCGCAGTCTGTGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 4, 1: 0, 2: 2, 3: 25, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200251614_1200251616 -2 Left 1200251614 X:154557146-154557168 CCAAGCACCACAGACTGCGGGGC 0: 4
1: 0
2: 2
3: 25
4: 206
Right 1200251616 X:154557167-154557189 GCCGAAGCCACAGAAACGCGTGG 0: 4
1: 0
2: 0
3: 2
4: 42
1200251614_1200251621 20 Left 1200251614 X:154557146-154557168 CCAAGCACCACAGACTGCGGGGC 0: 4
1: 0
2: 2
3: 25
4: 206
Right 1200251621 X:154557189-154557211 GCCTCCCGCTTCTGGAGGCCTGG 0: 4
1: 0
2: 2
3: 28
4: 286
1200251614_1200251623 23 Left 1200251614 X:154557146-154557168 CCAAGCACCACAGACTGCGGGGC 0: 4
1: 0
2: 2
3: 25
4: 206
Right 1200251623 X:154557192-154557214 TCCCGCTTCTGGAGGCCTGGAGG 0: 4
1: 0
2: 3
3: 15
4: 225
1200251614_1200251619 12 Left 1200251614 X:154557146-154557168 CCAAGCACCACAGACTGCGGGGC 0: 4
1: 0
2: 2
3: 25
4: 206
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40
1200251614_1200251620 15 Left 1200251614 X:154557146-154557168 CCAAGCACCACAGACTGCGGGGC 0: 4
1: 0
2: 2
3: 25
4: 206
Right 1200251620 X:154557184-154557206 GCGTGGCCTCCCGCTTCTGGAGG 0: 4
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200251614 Original CRISPR GCCCCGCAGTCTGTGGTGCT TGG (reversed) Intronic
900585186 1:3429222-3429244 GGCCCCCATTCTGTGGGGCTTGG + Intronic
902110784 1:14076536-14076558 GCCACCTAGTCTGTGGTACTTGG + Intergenic
902167643 1:14585204-14585226 GCCCCCTAGTCGGTGGTTCTTGG + Intergenic
904455700 1:30646884-30646906 GCCCTGCAGTGTCTGGGGCTTGG - Intergenic
906012025 1:42536713-42536735 GCCACCTAGTCTGTGGTGTTTGG - Intronic
907387353 1:54134642-54134664 GTCACCCAGTCTCTGGTGCTGGG - Intronic
907567107 1:55445573-55445595 GCCACCCAGTTTGTGGTACTGGG + Intergenic
909471518 1:76034119-76034141 GCCACTCAGTCTGTGGTATTTGG + Intergenic
910691577 1:89970816-89970838 GCTACCCAGTCTGTGGTACTTGG + Intergenic
913087386 1:115451553-115451575 TCCAAGCAGTATGTGGTGCTGGG - Intergenic
913461734 1:119093738-119093760 GCCACCCAGTTTGTGGTACTTGG + Intronic
914919819 1:151839203-151839225 GCGGCGCAGTCTGGGGGGCTGGG + Exonic
915165646 1:153946456-153946478 GCCCCGCGCTCTGCGGTCCTCGG - Exonic
915608147 1:156968020-156968042 GCCCTGCCGCCTGTGGTGCTGGG + Exonic
916559058 1:165917192-165917214 GAGCCTCAGTCAGTGGTGCTAGG + Intergenic
921711610 1:218378648-218378670 GCCACCCAGTCTGGGGTGCAGGG + Intronic
923561092 1:235042629-235042651 GCCTCGCAGTCTGTGGCACCTGG - Intergenic
1063946224 10:11178848-11178870 GCACAGCATTCTGTGTTGCTAGG - Intronic
1070558322 10:77546780-77546802 GCCCCGCCATCTTTGGGGCTGGG - Intronic
1070591181 10:77802213-77802235 GCCACACAGTCTGTGGTAATTGG + Intronic
1070701242 10:78603151-78603173 GTCCCCCAGTTTGTGGTACTTGG - Intergenic
1071348464 10:84715761-84715783 GCCCAGCATTCTGTGTTTCTTGG + Intergenic
1072219870 10:93318005-93318027 TCCCCACACCCTGTGGTGCTTGG - Intronic
1072609234 10:97005436-97005458 GCCCCCTGGTCTGTGGAGCTGGG + Intronic
1073255459 10:102148020-102148042 ACCCAGCTATCTGTGGTGCTGGG - Intronic
1074848542 10:117420366-117420388 GCCTCTCTGTCTTTGGTGCTAGG - Intergenic
1075407880 10:122206618-122206640 ACCGCCCAGTCTGTGGTCCTTGG + Intronic
1075789558 10:125073965-125073987 CCCCAGCATTCTGTGGTGCTGGG - Intronic
1077466096 11:2734436-2734458 GCCCCGCAGCCAGCTGTGCTGGG + Intronic
1078387821 11:10908398-10908420 GTCACCCAGTTTGTGGTGCTTGG - Intergenic
1082236744 11:49826630-49826652 GGGCCGCAGCCTGTGGTGATGGG + Intergenic
1082240190 11:49861125-49861147 GGGCCGCAGCCTGTGGTGATGGG + Intergenic
1082810596 11:57476898-57476920 GCACCGCAGTCAGAGGTGGTGGG - Exonic
1083593854 11:63909862-63909884 GCCCTGCAGTGGGTGGGGCTGGG + Exonic
1084272700 11:68037720-68037742 GCCCCACAGCCTGTGGCACTGGG + Intergenic
1086916506 11:92535419-92535441 GCTACCCAGTTTGTGGTGCTTGG + Intronic
1087557374 11:99738408-99738430 GCCACCCAGTCTGTGGTATTTGG + Intronic
1088755539 11:112882235-112882257 GCCACCTAGTCTGTGGTCCTTGG - Intergenic
1090172354 11:124616162-124616184 GCCACCCAGTTGGTGGTGCTTGG - Intronic
1091187772 11:133661990-133662012 GAACCCCAGTCTTTGGTGCTAGG - Intergenic
1091283210 11:134394047-134394069 GCCCGGGAGGCGGTGGTGCTGGG - Intronic
1092484810 12:8893394-8893416 GTCCCCCAGTCTGGGGTGCAGGG + Intergenic
1092669782 12:10849625-10849647 GCCCAGCAGGATGTGGTGGTAGG + Intronic
1092946199 12:13456660-13456682 GGTCCTCAGTCTGTGGTCCTGGG + Intergenic
1096059266 12:48682529-48682551 GACCCTCAGTCTGTGGTCCTAGG + Intergenic
1101739927 12:107492888-107492910 GCCCTGCAGCTTCTGGTGCTGGG + Intronic
1101788978 12:107911258-107911280 CCCACGAAGTGTGTGGTGCTTGG + Intergenic
1102784767 12:115595505-115595527 GTCACCCAGTCTGTGGTGCTTGG + Intergenic
1103259687 12:119575827-119575849 GACTCGCACTCTGAGGTGCTGGG - Intergenic
1104522269 12:129486680-129486702 GCACCTCATTCTATGGTGCTGGG - Intronic
1104848157 12:131857572-131857594 GCCCTGCAGCCAGTGGTGTTGGG + Intergenic
1105996817 13:25680491-25680513 GCCACCCAGTTTGTGGTACTTGG + Intronic
1106139622 13:27001297-27001319 GCCACCCGGTCTGTGGGGCTTGG + Intergenic
1107997853 13:45878416-45878438 GCCACCCAGTCTGTGTTACTTGG + Intergenic
1109560916 13:64049179-64049201 GCCACCCAGTCTGTGGTATTTGG - Intergenic
1111822247 13:93228024-93228046 GCCACTCAGACTGTGGCGCTGGG - Intronic
1112286589 13:98110328-98110350 GTCACCCAGTCTGGGGTGCTGGG + Intergenic
1113074495 13:106454552-106454574 GCCCATCTGTCTGGGGTGCTGGG + Intergenic
1114112129 14:19485492-19485514 GCCCGGCAGGTTGAGGTGCTAGG + Intergenic
1115270233 14:31543368-31543390 GCTCAGGAATCTGTGGTGCTAGG - Intronic
1116391382 14:44394798-44394820 GCCACTCAGTTTGTGGTACTTGG + Intergenic
1116997595 14:51339982-51340004 GCCACCCAGTTTGTGGTACTTGG - Intergenic
1118467071 14:66040689-66040711 GCCCAGGAATCAGTGGTGCTCGG + Intergenic
1119866325 14:77978190-77978212 GCCCCCCAGTCTATGGTAATTGG - Intergenic
1120865642 14:89293335-89293357 ACCCCCCAGTCTGTGGCACTTGG - Intronic
1121360565 14:93254516-93254538 GCCCCAGAGCCTGTGTTGCTAGG - Intronic
1121683764 14:95816520-95816542 GTCACCCAGTCTGTGGTGATTGG - Intergenic
1122475739 14:102007774-102007796 GCCACACAGCCTGTGCTGCTTGG - Intronic
1122962543 14:105102635-105102657 GCCCAGCAGTGTGCAGTGCTAGG + Intergenic
1123032174 14:105457076-105457098 GCCCCGCACTCCGTGGTCCTTGG + Intronic
1125831413 15:42719375-42719397 TCCCCTCAGCCTGTGGTGATGGG - Intronic
1127698713 15:61476091-61476113 GCCACTCAGAGTGTGGTGCTAGG + Intergenic
1129389523 15:75213695-75213717 GACCCCCAGTCTGAGGTGGTGGG + Intergenic
1129747969 15:78038179-78038201 GCCAGGCAGTGTGAGGTGCTGGG + Intronic
1130209155 15:81907440-81907462 GCCTTGCACTCTGTGGTCCTTGG - Intergenic
1130222317 15:82030102-82030124 GCCACTCAGTTTGTGGTACTTGG + Intergenic
1130486129 15:84399313-84399335 GCCCCGCAGCCAGTGCTCCTTGG + Intergenic
1132729826 16:1355896-1355918 GCCAGGCAGTCCCTGGTGCTTGG + Intronic
1132730156 16:1357079-1357101 GTCCCACAGCCTGGGGTGCTTGG - Intronic
1135138468 16:19902044-19902066 GCCCCACAGTCTGTGGTACTTGG + Intergenic
1139966748 16:70749941-70749963 TCCCCACAGTCTCTGTTGCTGGG - Intronic
1141447239 16:84068983-84069005 GACCTGGAGTCTGTGCTGCTGGG - Intronic
1141775043 16:86117472-86117494 CCCCCAGAGTCTGTGGTGCAGGG - Intergenic
1142173993 16:88636638-88636660 ACCCCCCAGTTTGTGGTGCATGG + Intergenic
1142223438 16:88866171-88866193 ACCCTGCAGTCTGTGTGGCTGGG + Intronic
1142263746 16:89054258-89054280 GCCACGCAATCTGAGGTTCTGGG - Intergenic
1144003320 17:11075839-11075861 GCCACACAGTCTATGGTACTTGG - Intergenic
1144282889 17:13744613-13744635 GCCCTCCAGTCTGTGGTACTTGG - Intergenic
1146542159 17:33705797-33705819 GCCACGAAGTCTGTGGTAATTGG + Intronic
1147907850 17:43834168-43834190 GCCCCACAGGCTGTAGTGCATGG + Intergenic
1147947061 17:44086316-44086338 GCCCCACAGCCTGAAGTGCTGGG - Intronic
1150250372 17:63701138-63701160 GCCACGCAGTCCCTGGTGCCCGG - Intronic
1151755759 17:76074554-76074576 CCCCCGCAGTCGGGGGTTCTGGG - Intronic
1151991468 17:77577663-77577685 GCCCCTCGGTGTGTGGTACTTGG - Intergenic
1152007709 17:77693014-77693036 GCAGGGCAGTCTGTGTTGCTGGG - Intergenic
1152533778 17:80938302-80938324 GCCCGGCACTCTATGGTCCTGGG - Intronic
1152569996 17:81117559-81117581 GCCCCGCAGTCAGTGTTGGGGGG - Exonic
1152602946 17:81274260-81274282 GGCACCCAGTCTTTGGTGCTTGG + Intronic
1152608214 17:81303481-81303503 GACCGTCAGTCTGTGGAGCTGGG - Intergenic
1155198683 18:23499024-23499046 GCCCCTCAGTCTGTGTGTCTAGG + Intergenic
1155397211 18:25398989-25399011 GCCACCCAGTCTGTGGTCTTTGG + Intergenic
1156481310 18:37438148-37438170 GCCCCTCAGTCTGTGGTTTTTGG + Intronic
1160625381 18:80200916-80200938 GTCCCGCTGACTGTGGAGCTGGG - Intronic
1160964213 19:1738840-1738862 GCCCCTGAGTCTGTGGTTCTCGG - Intergenic
1162122063 19:8476885-8476907 GCCCAGGAGTCGGTGGTGGTGGG - Intronic
1162538644 19:11279704-11279726 GCTTCCCTGTCTGTGGTGCTTGG + Intergenic
1163683612 19:18697621-18697643 GCCCTGCTGTCTTTGGTGCATGG + Intronic
1164570609 19:29371976-29371998 GCTCGGCACTCTGTGGTGCTTGG - Intergenic
1165720361 19:38074555-38074577 GCCCCACAGTCCGCTGTGCTGGG - Intronic
1167051515 19:47081797-47081819 GCCCTGCAGTCTGGAGTGCCGGG - Intronic
1167429789 19:49447711-49447733 GCCCTGGAGTCTGTGCTACTAGG - Intronic
1167553786 19:50179839-50179861 GCCACACAGTTTCTGGTGCTTGG + Intergenic
1168275372 19:55274992-55275014 AGCCAGTAGTCTGTGGTGCTTGG + Intronic
1168562867 19:57397943-57397965 GCCCCACAGTCTGTACTTCTGGG + Intronic
925015431 2:520841-520863 GCCCATCAGCCTGTGGTGCCAGG - Intergenic
925303460 2:2833211-2833233 GCCCCCTAGTCTGTGGTCATTGG - Intergenic
926410712 2:12599368-12599390 GCCACCCAGTCTGTGGTATTTGG + Intergenic
926628330 2:15114193-15114215 GCCACCCAGCCTGTGGTACTTGG - Intergenic
926931831 2:18048723-18048745 GCCACCCAGTCTGTGGTTCTTGG - Intronic
929958444 2:46478406-46478428 GCCAACCAGTCTGTGGTTCTTGG - Intronic
932137883 2:69246506-69246528 GCCCAGAAGTCTGTGGTGCATGG - Exonic
935783455 2:106528064-106528086 GCCCCCCAGTCGGTGATGCCCGG - Intergenic
936013153 2:108938438-108938460 TTCCCGCAGTTTGTGGTGCTCGG + Intronic
936921359 2:117691966-117691988 GCCCCGCACACTGTGTTGATGGG + Intergenic
937970049 2:127542344-127542366 GCCCCACTCTCAGTGGTGCTGGG - Intronic
937975556 2:127580380-127580402 GCCCCTCAGTCCATGCTGCTGGG - Intronic
941066943 2:160914114-160914136 GCCACCCAGTCTTTGGTGTTTGG - Intergenic
941082495 2:161078120-161078142 GCCACCCAGTCTGTGGCACTTGG - Intergenic
942860004 2:180598101-180598123 GCCACTCAGTTTGTGGTACTTGG - Intergenic
947161969 2:227224005-227224027 GCCCAGCAGTCTGGCCTGCTTGG - Intronic
947823613 2:233089458-233089480 GCCCTGCAGCCTGGGGCGCTGGG + Intronic
948072765 2:235140865-235140887 GACCAGGGGTCTGTGGTGCTGGG - Intergenic
1169078880 20:2782375-2782397 GCTACCCAGTCTGTGGTACTTGG - Intergenic
1172376525 20:34446090-34446112 GCTATGCAGTCTTTGGTGCTAGG + Intronic
1172633022 20:36391713-36391735 ACCCCCCAGTCTATAGTGCTGGG + Intronic
1173549560 20:43923197-43923219 GCCCCACAGGCTGGGGTGCAAGG - Intronic
1175176487 20:57115405-57115427 GCCATCCAGTCTGTGGTGTTCGG - Intergenic
1175448488 20:59042810-59042832 GCGCCGCCGGCTGGGGTGCTGGG - Exonic
1176380496 21:6110352-6110374 CCCCCGCAGCATGTGGGGCTGGG - Intergenic
1179541792 21:42087728-42087750 AGCCCCCAGTCTGTGGTCCTTGG - Intronic
1179720118 21:43311518-43311540 GCCAGGCGGTTTGTGGTGCTTGG - Intergenic
1179742976 21:43427888-43427910 CCCCCGCAGCATGTGGGGCTGGG + Intergenic
1184279138 22:43427135-43427157 GTCCCACTGTATGTGGTGCTGGG - Intronic
1184749012 22:46473523-46473545 GCCCCCCAGGCTTTGGTGCATGG - Intronic
1185014463 22:48335023-48335045 GCCTCCCAGGGTGTGGTGCTGGG + Intergenic
949398209 3:3637598-3637620 GCCACCCAGTCTGTGGTACTTGG - Intergenic
950113836 3:10437990-10438012 GCCACTCAGTCTGTGGTCTTTGG + Intronic
953327514 3:42025150-42025172 GCCCCGCTTTCTGCTGTGCTTGG + Intronic
953549519 3:43890587-43890609 GCCACAAAGTCTGTGCTGCTTGG - Intergenic
953980499 3:47410799-47410821 GCCCCTCAGCCTGGGGTCCTGGG + Exonic
955973434 3:64458599-64458621 ACCACCCAGTCTGTGGTACTTGG + Intergenic
956849081 3:73211891-73211913 GCCCCATAGTCTGTCATGCTTGG + Intergenic
957612266 3:82483540-82483562 GCCACCCAGTCTGTGGTATTTGG + Intergenic
960427576 3:117527685-117527707 GCCACTCAGTTTGTGGTACTTGG + Intergenic
961175736 3:124833776-124833798 GCCCAGCAGTGTCTGGTGCTGGG + Intronic
961749021 3:129084813-129084835 GCTCCACAGTCTGTGCTGGTTGG - Intergenic
962940157 3:140118267-140118289 GCCACCCAGTCTGTGGTACTTGG + Intronic
964309837 3:155380761-155380783 GCTACCCAGTCTGTGGTACTTGG + Intronic
967968209 3:194979277-194979299 GCCACCCACTCTGTGGTACTTGG - Intergenic
970485545 4:16521151-16521173 GCCACCCAGTCTGTGGTACCAGG - Intronic
973637606 4:52874541-52874563 GCCACCCAGTTTGTGGTACTAGG - Intronic
974193371 4:58537200-58537222 GCCATGCAGTCTGTGGTAATTGG - Intergenic
979720112 4:123889626-123889648 ACCCCACAGTCTGGGGTTCTGGG - Intergenic
979954588 4:126936180-126936202 GCCACCCAGTTTGTGGTACTTGG + Intergenic
981717981 4:147770813-147770835 GCTGCCCAGTCTGTGGTACTCGG - Intronic
985010743 4:185579918-185579940 GCCCCCCAGTCTCTGGTACCTGG - Intergenic
986007209 5:3677992-3678014 GCCCCACAGTCTGAGCAGCTGGG - Intergenic
986241878 5:5967525-5967547 GCCCCTAAGTCTATGGTACTTGG - Intergenic
986790470 5:11154670-11154692 GCCACCCAGTTTGTGGTACTCGG - Intronic
987204775 5:15613801-15613823 GCCCCCCAGTCTATGGTATTTGG - Intronic
987367454 5:17161800-17161822 GCCACACAGTTTGTGGTGTTTGG - Intronic
989183530 5:38601351-38601373 GCCACCCAGTCTGTGGTGTCTGG + Intronic
990585871 5:57210671-57210693 GCCACCCAGTCTGTGGTATTTGG - Intronic
990873180 5:60456071-60456093 GCCCCACACTCTTTGGTCCTAGG + Intronic
991125143 5:63061237-63061259 GCCACTCAGTCTGTAGTGTTTGG + Intergenic
991529148 5:67596127-67596149 GCCACATAGTCTGTGGTACTTGG - Intergenic
992202414 5:74397479-74397501 GCCACAGAATCTGTGGTGCTTGG - Intergenic
992688996 5:79225215-79225237 GGCCCTCAGTCTGTCATGCTGGG - Intronic
994598302 5:101867915-101867937 GCCACTCAATCTGTGGTACTTGG - Intergenic
995095030 5:108225692-108225714 GCCACTCAGTTTGTGGTACTTGG + Intronic
997262061 5:132473042-132473064 GCCCCACAGTCTGTAGTGGTTGG + Intronic
1002915309 6:1524057-1524079 GCCCCGCACTCTGTGGCTCGGGG - Intergenic
1003116083 6:3284708-3284730 GCCCGGCTGTCTGTGCTGCCAGG - Intronic
1003162809 6:3650719-3650741 GGCCCGCAGGCTGTGGCGCAGGG + Intergenic
1004285334 6:14316066-14316088 GCCGGACAGTCTCTGGTGCTAGG - Intergenic
1004422962 6:15488012-15488034 GCCGAGCAGTCTGTGGAACTGGG + Intronic
1007509421 6:42363915-42363937 GCCACCCAGTGTGTGGTACTTGG + Intronic
1007772618 6:44203246-44203268 GCCCCAGAGTCTGTGCAGCTGGG - Intergenic
1011128219 6:84029414-84029436 GCCACCCAGTCTGTGGTACATGG - Intergenic
1013756167 6:113464346-113464368 GCCTCCCAGTCTGTGATACTTGG - Intergenic
1015527146 6:134184720-134184742 GTCCCGCAGTCTGGAGTGCAGGG + Intronic
1016796499 6:148123638-148123660 GCCACCCAGTCTGTGGTATTTGG - Intergenic
1018088445 6:160325330-160325352 GCCCCCAAGTCTGTGGTACTTGG - Intergenic
1018383329 6:163280556-163280578 GCCGCTCAGTCTCTGGTGTTTGG - Intronic
1021623725 7:22572510-22572532 GCCACCCAGTCTGTGGTGCTTGG - Intronic
1021979643 7:26041628-26041650 GCCCCCCAGTTTGTGGTACTTGG + Intergenic
1022958604 7:35403717-35403739 GCCACCCAGTCTATGGTGCTTGG + Intergenic
1025144926 7:56494367-56494389 GGGCCTCAGTCTGTGGTGCTGGG + Intergenic
1025260516 7:57414822-57414844 GGGCCTCAGTCTGTGGTGCTGGG + Intergenic
1027121896 7:75527902-75527924 GCCCCGGAGTCGGCGGCGCTGGG - Intergenic
1028583011 7:92425861-92425883 GCCCCTGACTCTGCGGTGCTGGG + Intergenic
1030635140 7:111939669-111939691 GCCATGCAGTTTGTGGTACTTGG + Intronic
1031445673 7:121850513-121850535 GCCACTCAGTCTTTGGAGCTTGG + Intergenic
1034969996 7:155412947-155412969 GCCGCACAGTGTGTGGTGCAGGG + Intergenic
1035118228 7:156543008-156543030 GCCCCAGAGGCTGTGGTGGTGGG + Intergenic
1035413287 7:158663421-158663443 GCCCCTCAGTCAGTTATGCTGGG - Intronic
1036211362 8:6843750-6843772 GCCACGCTGTCGGTGGTTCTTGG + Intergenic
1036815830 8:11902369-11902391 GCCCCGCAGCCGCTGGAGCTCGG - Intergenic
1037727850 8:21498014-21498036 GCCACCCAGTTTGTGGTACTTGG + Intergenic
1038796644 8:30716330-30716352 GCCCCAAAGTGTGTTGTGCTGGG - Intronic
1041709153 8:60877021-60877043 GCCACGCAGTCTGTGGTACCTGG + Intergenic
1041864078 8:62548522-62548544 GCCCAGGACTCTGTGGTGCCTGG - Intronic
1042168468 8:65970099-65970121 GCCACCCAGTCTGTGGTACCTGG + Intergenic
1047920300 8:129628478-129628500 GCACCGCAGGCTGTGATGATGGG - Intergenic
1048945992 8:139447802-139447824 GCCACCCAGTCTGTGGTATTTGG - Intergenic
1049157888 8:141078060-141078082 GCCGCCCAGCTTGTGGTGCTTGG - Intergenic
1049250222 8:141584232-141584254 GTCATGCAGTCTGTGGAGCTTGG + Intergenic
1049268549 8:141682247-141682269 GCCACGCTGTGTGTGGTGCTTGG - Intergenic
1049411566 8:142475945-142475967 GCCCCGAAGAGGGTGGTGCTTGG + Intronic
1049689947 8:143953974-143953996 CCCCCCCAGCCTGTGGTTCTGGG + Intronic
1050158252 9:2690700-2690722 GCCACTCAGTCTGTGGTACTTGG - Intergenic
1050431973 9:5571446-5571468 GCCCTGCTCTCTGTGGTGTTAGG - Intergenic
1051063406 9:13072442-13072464 GCCACCCAATCTGTGGTACTTGG - Intergenic
1051565387 9:18491122-18491144 GCCTCTCTGTCTCTGGTGCTGGG - Intronic
1056501095 9:87210125-87210147 GCCACCCAGTTTGTGGTACTAGG + Intergenic
1056695107 9:88841810-88841832 GGCTTGCAGACTGTGGTGCTGGG + Intergenic
1061989817 9:134152772-134152794 GCCTCCCAGCCTGTGGGGCTTGG - Intronic
1062464295 9:136674364-136674386 GCCCCGCAGCCTGTGCCCCTGGG + Intronic
1186513694 X:10150171-10150193 GCCACCCAGTCTGTGGGACTTGG - Intergenic
1186515965 X:10166343-10166365 GCCACCCAGTCCGTGGTGCTTGG + Intronic
1190336497 X:49265957-49265979 GTCCCGCTTTCTTTGGTGCTGGG + Intergenic
1194649290 X:96496656-96496678 GCCACTCAGTCTATGGTACTTGG + Intergenic
1195105654 X:101599766-101599788 GCCGCGATCTCTGTGGTGCTGGG + Intergenic
1200251614 X:154557146-154557168 GCCCCGCAGTCTGTGGTGCTTGG - Intronic
1200253821 X:154568830-154568852 GCCCCGCAGTCTGTGGTGCTTGG - Intergenic
1200263948 X:154635578-154635600 GCCCCGCAGTCTGTGGTGCTTGG + Intergenic
1200266153 X:154647270-154647292 GCCCCGCAGTCTGTGGTGCTTGG + Intergenic