ID: 1200251615

View in Genome Browser
Species Human (GRCh38)
Location X:154557153-154557175
Sequence GGCTTCGGCCCCGCAGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 4, 1: 0, 2: 0, 3: 17, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200251615_1200251626 28 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251626 X:154557204-154557226 AGGCCTGGAGGCTGAGCTAGCGG 0: 4
1: 0
2: 1
3: 37
4: 444
1200251615_1200251623 16 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251623 X:154557192-154557214 TCCCGCTTCTGGAGGCCTGGAGG 0: 4
1: 0
2: 3
3: 15
4: 225
1200251615_1200251620 8 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251620 X:154557184-154557206 GCGTGGCCTCCCGCTTCTGGAGG 0: 4
1: 0
2: 1
3: 8
4: 113
1200251615_1200251616 -9 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251616 X:154557167-154557189 GCCGAAGCCACAGAAACGCGTGG 0: 4
1: 0
2: 0
3: 2
4: 42
1200251615_1200251621 13 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251621 X:154557189-154557211 GCCTCCCGCTTCTGGAGGCCTGG 0: 4
1: 0
2: 2
3: 28
4: 286
1200251615_1200251619 5 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200251615 Original CRISPR GGCTTCGGCCCCGCAGTCTG TGG (reversed) Intronic
900207888 1:1439376-1439398 GGCTTCGGGCCCGGAGTCGGGGG + Exonic
900425413 1:2576164-2576186 GGCTTCAGCCACTCAGTCTGTGG - Intergenic
900743642 1:4345463-4345485 GGTCTCGGCCCTGCACTCTGAGG + Intergenic
901855573 1:12042268-12042290 TGCTTAAGCCCTGCAGTCTGTGG - Intergenic
902054841 1:13591776-13591798 GGCTTCGGCCCAGGAATCTGAGG - Intronic
902328312 1:15717164-15717186 GGCTTGAGCCCCGGAGTTTGAGG + Intronic
902999201 1:20252754-20252776 GGCTTCAGCCACCCAGTCTGTGG + Intergenic
903193557 1:21669410-21669432 GGCTTGGGCTCCGCAGTGAGTGG - Intergenic
905885348 1:41488706-41488728 GGAGCCGGCCCCGCAGGCTGAGG - Intergenic
906618900 1:47257409-47257431 GGCTTCAGCCCAGGAGTTTGAGG + Intronic
906699765 1:47849444-47849466 TGCTTCGGCCACCCAGTCTGTGG + Intronic
907938337 1:59062990-59063012 GGCTGTGGCCCCACAGTATGTGG + Intergenic
908132056 1:61083356-61083378 GGCTGCGGCAGCGCAGGCTGCGG - Intronic
913565639 1:120069723-120069745 GGCCTCGGCCCCGCCGCCTTGGG + Intergenic
913632490 1:120723830-120723852 GGCCTCGGCCCCGCCGCCTTGGG - Intergenic
914286235 1:146229097-146229119 GGCCTCGGCCCCGCCGCCTTGGG + Intergenic
914547263 1:148679839-148679861 GGCCTCGGCCCCGCCGCCTTGGG + Intergenic
914619240 1:149390504-149390526 GGCCTCGGCCCCGCCGCCTTGGG - Intergenic
915225059 1:154405770-154405792 GCCTTGGTCACCGCAGTCTGTGG + Intronic
915610023 1:156984374-156984396 GGCTTCGGCTTCACAGTCAGTGG - Exonic
916637129 1:166684271-166684293 TGCTTCAGCCCAGGAGTCTGAGG + Intergenic
924019290 1:239764005-239764027 GGCTTGAGCCCAGCAGTTTGAGG + Intronic
1064555317 10:16541754-16541776 TGCTTAAGCCCCCCAGTCTGTGG + Intergenic
1065351122 10:24796576-24796598 GGCTTCAGCCCAGCAGTTAGTGG + Intergenic
1065696011 10:28380244-28380266 GGCTTGAGCCCAGGAGTCTGAGG + Intergenic
1069358352 10:67613766-67613788 GGCTTAAGCCACCCAGTCTGTGG - Intronic
1071269111 10:83990837-83990859 GGCTTGAGCCCAGGAGTCTGAGG + Intergenic
1076288365 10:129323573-129323595 GGCTGTTGCCACGCAGTCTGGGG + Intergenic
1076762996 10:132614957-132614979 GGCGTAGGCCCCGCAGGCTGCGG + Intronic
1076895312 10:133308667-133308689 GGCTTCGGCCCCAGAGTTCGGGG + Exonic
1077020875 11:416721-416743 GGCTGCGGCCCCGCAGGCCGAGG + Intronic
1083888735 11:65585311-65585333 GGCCTCGGCCCCGCCGTCCTTGG - Exonic
1083953081 11:65967465-65967487 GACCCCGTCCCCGCAGTCTGAGG - Exonic
1084272698 11:68037713-68037735 CGCTTGGGCCCCACAGCCTGTGG + Intergenic
1084495788 11:69502260-69502282 GGCTCAGGCCCCAGAGTCTGGGG + Intergenic
1084709351 11:70834472-70834494 GGCTTGGCCCCCGCTGGCTGAGG - Intronic
1086678132 11:89635055-89635077 GGCTTGAGCCCAGCAGTTTGAGG + Intergenic
1087728184 11:101747640-101747662 GGCTTAAGCCCCGGAGTTTGAGG - Intronic
1088117077 11:106324465-106324487 TGCTTCGGCCCAGGAGTTTGAGG + Intergenic
1088981450 11:114867943-114867965 GGCTTCAGCCCAGGAGTTTGAGG + Intergenic
1089504025 11:118951502-118951524 GGCTTGAGCCCAGGAGTCTGAGG - Intronic
1090235637 11:125144816-125144838 TGTTTAAGCCCCGCAGTCTGTGG - Intergenic
1091531258 12:1358117-1358139 GGCTTGAGCCCAGCAGTTTGAGG + Intronic
1092480052 12:8851622-8851644 AGCTTCAGCCCAGCAGTTTGAGG - Intronic
1097980033 12:65729117-65729139 GGCGTCGGCTCCTGAGTCTGCGG - Intergenic
1099435549 12:82640661-82640683 TGCTTCAGCCCAGGAGTCTGAGG + Intergenic
1100205810 12:92348075-92348097 GGCTTTAGCCCCGGAGTTTGAGG + Intergenic
1102102145 12:110288021-110288043 GGCTTCAGCCCAGGTGTCTGAGG - Intronic
1102839527 12:116103334-116103356 GGCTTCAGCCCAGGAGTTTGAGG - Intronic
1103034737 12:117647399-117647421 GGCTTGGCCCCATCAGTCTGTGG - Intronic
1103822854 12:123712433-123712455 GGCCGCGGCCCCGCACTATGGGG - Exonic
1104050823 12:125192559-125192581 GTCTTCAGCCCGGGAGTCTGAGG - Intronic
1107660922 13:42638357-42638379 TGCTTAGGCCACCCAGTCTGTGG + Intergenic
1111813024 13:93115691-93115713 GGCTTGGGCCCAGGAGTTTGAGG - Intergenic
1112146877 13:96709738-96709760 TGCTTCAGCCCCCCAGGCTGTGG + Intronic
1113913797 13:113858032-113858054 GGCTCCGGCCCCTCAGGCAGGGG + Intronic
1114884966 14:26837547-26837569 GGCTTGAGCCCAGGAGTCTGAGG + Intergenic
1115219349 14:31044423-31044445 GGCTTCAGCCCAGGAGACTGAGG - Intronic
1116002531 14:39259612-39259634 TGCTTCAGCCCAGCAGGCTGAGG - Intronic
1117122629 14:52584693-52584715 GGCTTCAGCCCAGGAGTTTGAGG - Intronic
1118664411 14:68051680-68051702 TGCTTCAGCCCAGGAGTCTGAGG - Intronic
1121537232 14:94699288-94699310 GGCTGCAGCCCTGCCGTCTGTGG + Intergenic
1122284589 14:100643183-100643205 TGCTTGAGCCCCTCAGTCTGTGG + Intergenic
1122883063 14:104698795-104698817 GGCTGAGGCCCCGGAGGCTGAGG - Intronic
1126738163 15:51751961-51751983 GGCTGCGGCACCGCAGTGCGGGG - Intronic
1127342750 15:58065262-58065284 GGCTCCTGCCCCGGACTCTGAGG - Intronic
1127364212 15:58272180-58272202 TGCTTAGGCCCCACAGTCTGGGG - Intronic
1127587340 15:60391207-60391229 GGCATTGGCCCAGGAGTCTGGGG - Intronic
1127969250 15:63945909-63945931 GGCTTGGACCCAGCAGTGTGTGG - Intronic
1128242983 15:66114016-66114038 GACTGGGGCCCAGCAGTCTGTGG + Intronic
1129120238 15:73392005-73392027 GCCTTCTGCCCAGGAGTCTGGGG - Intergenic
1130381968 15:83379183-83379205 GGCCTGGGCCGCGCAGTCTGTGG - Intergenic
1130510184 15:84582732-84582754 GGCTTAAGCCACCCAGTCTGTGG - Intergenic
1132700744 16:1221017-1221039 GGCTTTGGCCCTGGGGTCTGGGG + Exonic
1132835019 16:1948616-1948638 TGCTTCGGCCCGGGAGGCTGAGG - Intronic
1133003735 16:2865657-2865679 GGCTTCAGCCCTGCAAACTGTGG - Intergenic
1136573079 16:31108465-31108487 GGCTCCGGCCCCGCGGTAAGTGG + Intronic
1137561535 16:49505547-49505569 AGCTTCTGCCCTGCAGCCTGGGG - Intronic
1138453087 16:57105517-57105539 GGCTTGGGCCCAGGAGTTTGGGG - Intronic
1139538483 16:67595239-67595261 GGCTTGGGCCCAGAAGTTTGAGG - Intronic
1142419251 16:89960423-89960445 CGCTTGGGCCCTGGAGTCTGAGG + Intronic
1142420078 16:89964584-89964606 GGCCTGGGCCCCGCACTCGGGGG + Intronic
1145110402 17:20156615-20156637 GCCGCCGGCCCCGCAGTTTGTGG + Intronic
1146229130 17:31093412-31093434 CACTTCGGCCCAGGAGTCTGAGG + Intergenic
1146686113 17:34842580-34842602 GGCATTGGCCACGCAGTGTGTGG + Intergenic
1146924723 17:36736327-36736349 GGCCTCTGCCCCGCAGTCTCAGG + Intergenic
1148130929 17:45262242-45262264 GGCTTCGGGCCCGCAGCCTTCGG - Intergenic
1148677174 17:49452181-49452203 GGCCTCGGTCCTGCAGGCTGTGG + Intronic
1152273787 17:79341956-79341978 GGCTTTGGCCCCCAAGGCTGGGG + Intronic
1152633841 17:81422559-81422581 GTCCCCGGCCCCACAGTCTGGGG - Intronic
1152927762 17:83095413-83095435 TGTTTCAGCCCCGCAGTCGGTGG - Intergenic
1153202112 18:2656573-2656595 GGTTGCGGCCCTGCAGTCTAGGG + Intronic
1154334350 18:13453991-13454013 GGCTCTGTCCCCGCAGTCGGCGG - Intronic
1155294808 18:24375229-24375251 GGCTTGAGCCCAGAAGTCTGAGG + Intronic
1155623892 18:27812752-27812774 GGTTTAGGCCACCCAGTCTGTGG + Intergenic
1157742246 18:50103655-50103677 GGCTTGAGCCCAGCAGTTTGGGG + Intronic
1160909046 19:1466430-1466452 GGCGGCTGCCCCGCTGTCTGTGG + Exonic
1161998696 19:7730239-7730261 GGGTTCGGCCCCGCGGGCTCAGG + Intronic
1162524399 19:11198952-11198974 GGCTTGAGCCCCGGAGTTTGAGG + Intergenic
1162834750 19:13308895-13308917 GGCTTCAGCCCAGAAGTTTGAGG - Intronic
1162889336 19:13721144-13721166 GGCTTGGGCCCAGGAGTTTGAGG - Intergenic
1163173648 19:15549882-15549904 CGCTTGGGCCCAGCAGTTTGAGG + Intronic
1163630914 19:18417603-18417625 GGCGACGGCCCCGGAGCCTGGGG - Intergenic
1163806890 19:19405241-19405263 AACTTCGGCCCCGGTGTCTGTGG - Intronic
1165385126 19:35505865-35505887 GCCCTTGGCCCCACAGTCTGGGG - Intronic
1167286141 19:48599770-48599792 GGCTTGGACCCCTCAGTCTGAGG + Intergenic
1167483425 19:49746551-49746573 GGCCTGGTCCCCGCAGGCTGGGG - Exonic
1167926074 19:52821752-52821774 CGCTCCGGCCCCGCCCTCTGCGG - Intronic
1167930258 19:52857738-52857760 CGCTCCGGCCCCGCCCTCTGCGG - Intergenic
925901511 2:8512503-8512525 TGCTTCAGCCACCCAGTCTGTGG - Intergenic
927811984 2:26185339-26185361 GGCCCCGGCCCCGGAGTATGTGG + Intronic
928514000 2:32028192-32028214 GGCTTGGGCCCAGGAGTTTGAGG - Intronic
931709275 2:64974211-64974233 GGCTTGAGCCCAGGAGTCTGAGG - Intergenic
934080080 2:88460223-88460245 GGCTTGAGCCCAGGAGTCTGAGG - Intergenic
934566796 2:95346036-95346058 GGCTTTGGCCCTGGCGTCTGCGG - Intronic
938698226 2:133853797-133853819 GGCTTGGGCCCAGGAGTTTGGGG + Intergenic
941881911 2:170489394-170489416 GGCTTCTGCACCGCACACTGGGG - Intronic
945225734 2:207529948-207529970 GGCTGCGGCTCCTCAGTCGGCGG + Exonic
946281935 2:218672067-218672089 GGCTAAGGACCCGGAGTCTGCGG - Exonic
948641202 2:239377074-239377096 GGCAGAGGCCCCGCAGGCTGGGG - Intronic
948857108 2:240735309-240735331 GGCTTTGGCCCCACACCCTGAGG - Intronic
948895726 2:240926035-240926057 GGCTTGGCCACAGCAGTCTGTGG + Intronic
948968809 2:241407308-241407330 GGCTTGAGGCCAGCAGTCTGAGG - Intronic
1172195497 20:33089072-33089094 GACTATGGCCCCTCAGTCTGGGG - Intronic
1172340173 20:34151347-34151369 GGCTTCGGCCCAGGAGGCAGAGG - Intergenic
1174601522 20:51728680-51728702 GGCTTGAGCCCAGGAGTCTGAGG + Intronic
1177072529 21:16528279-16528301 GGCTTTGGCCCCAGAGTTTGAGG - Intergenic
1180633960 22:17249397-17249419 GGCTTGAGCCCAGCAGTTTGAGG + Intergenic
1183546436 22:38456543-38456565 GGCCTGGGCCCCACACTCTGGGG + Intergenic
1184764247 22:46563468-46563490 GGCCTCGGCCCCGCAAGTTGGGG - Intergenic
952248471 3:31624498-31624520 GGCTGGGGCCTAGCAGTCTGTGG + Intronic
953767256 3:45753154-45753176 GGCTTGGGCCCCCCAGTGTTGGG + Intergenic
955508217 3:59653282-59653304 GGCTTGGGCCCTGGAGTTTGAGG - Intergenic
965098559 3:164268028-164268050 GGCTTGAGCCCAGCAGTTTGAGG + Intergenic
966932970 3:184687592-184687614 GGTTTGGGCCCCACAGGCTGTGG - Intergenic
966945287 3:184773453-184773475 GCCCTCGGCCCCGAAGTCAGGGG + Intergenic
969543980 4:7811798-7811820 TGTTTCAGCCACGCAGTCTGTGG + Intronic
971359370 4:25922660-25922682 GGCTTCTGCCCCACAGTCTCAGG - Intronic
972782596 4:42299155-42299177 GTCTTGGGCCTTGCAGTCTGAGG + Intergenic
973125648 4:46580685-46580707 GGCTTTGGTCACTCAGTCTGTGG + Intergenic
976400448 4:84601087-84601109 GGCTTGAGCCCAGGAGTCTGAGG + Intronic
978784796 4:112597438-112597460 GGCTTGGGCCCAGGAGTTTGAGG + Intronic
979205591 4:118033710-118033732 GACTTCGGCCGCTCAGGCTGCGG - Intronic
979612485 4:122703930-122703952 GGCTTCAGCCCAGGAGTTTGAGG - Intergenic
980040133 4:127929502-127929524 TGCTTCAGCCCAGGAGTCTGAGG + Intronic
980107760 4:128604095-128604117 GGCTTCAGCCCAGGAGTTTGAGG + Intergenic
982260682 4:153491788-153491810 GGCTTGAGCCCGGGAGTCTGAGG - Intronic
984749802 4:183261231-183261253 GGCTGAGGCCCCGAAGTCTGTGG + Exonic
985563201 5:602298-602320 GGCTTTGTCCCCCCAGTCTGTGG + Intergenic
985896064 5:2750820-2750842 GGTTTCCGCACCGCAGCCTGGGG - Intronic
989384357 5:40839682-40839704 TGCTTCGGCCCAGAAGTTTGAGG - Intergenic
992911603 5:81400947-81400969 GTCTTCAGCCCCGCAGTTTGTGG + Intergenic
997713929 5:136028644-136028666 GGCTTCGGTCCTGCATGCTGGGG - Intergenic
999253383 5:150195918-150195940 GGCTTCCTCCCCGCAGTTGGTGG + Intronic
999268647 5:150283456-150283478 TGCTTGAGCCCCGGAGTCTGAGG - Intronic
1001785033 5:174404714-174404736 AGTTTCAGCCCCCCAGTCTGTGG + Intergenic
1002915312 6:1524064-1524086 AGCTCGGGCCCCGCACTCTGTGG - Intergenic
1004003020 6:11612982-11613004 TGTTTAAGCCCCGCAGTCTGTGG + Intergenic
1006166123 6:32066308-32066330 GGCTTGAGCCCAGGAGTCTGGGG + Intronic
1006599015 6:35213715-35213737 GGCAGCGGCCCGGCAGCCTGGGG + Intergenic
1007750768 6:44069896-44069918 GGCTGGAGCCCAGCAGTCTGTGG - Intergenic
1012861019 6:104559591-104559613 GGCTTCAGCCCAGCAGTTCGAGG - Intergenic
1019275633 7:174043-174065 GGCATGGGCCCCCCATTCTGAGG - Intergenic
1019612570 7:1944445-1944467 GGTTTCAGCCCCGCAGGCTCTGG - Intronic
1019654993 7:2187550-2187572 GGCTTGGGCCCAGGAGTTTGTGG - Intronic
1019788439 7:2994503-2994525 TGCTTAGGCCACCCAGTCTGTGG - Intronic
1019965896 7:4498483-4498505 GGCTTCAGCCCAGGAGGCTGAGG - Intergenic
1020768244 7:12353125-12353147 TGTTTAAGCCCCGCAGTCTGTGG - Intronic
1025955099 7:66176742-66176764 GGCTTGAGCCCAGGAGTCTGAGG - Intergenic
1027218638 7:76200393-76200415 GGCTTCAGCCCAGGAGTTTGAGG + Intergenic
1029552455 7:101244726-101244748 GGCTCCAGGCCCGTAGTCTGAGG + Intronic
1034488934 7:151382568-151382590 GGATGCGGCCCCGCGATCTGTGG - Intronic
1036707503 8:11056192-11056214 TGCTTCTGCCTCCCAGTCTGGGG - Intronic
1039444264 8:37618414-37618436 GGCTTGGGCCCAGGAGTTTGAGG + Intergenic
1039560660 8:38510146-38510168 GGCTTCTGAGCCGCAGTCTCAGG - Intergenic
1041709152 8:60877014-60877036 TGTTTCAGCCACGCAGTCTGTGG + Intergenic
1045367983 8:101493801-101493823 GGCTCCGGCCGCGCAGGCTGTGG - Intronic
1047385861 8:124408674-124408696 GGCTTGGGCCTCGGAGGCTGAGG - Intergenic
1048277452 8:133077598-133077620 GGCTTCAGCCCTGCCGTCTCTGG - Intronic
1050823069 9:9907341-9907363 TGCTTCAGCCACCCAGTCTGTGG - Intronic
1052797838 9:32940288-32940310 GGCCACAGACCCGCAGTCTGGGG - Intergenic
1052821860 9:33143954-33143976 CGCTTGGGCCCAGCAGTTTGAGG - Intronic
1052933909 9:34077494-34077516 GGCTTGGGCCCAGAAGTTTGAGG + Intergenic
1053067725 9:35079956-35079978 AGTTTCGGCCCCACAGTCCGTGG + Exonic
1054920606 9:70539163-70539185 GGCTGGGCCCCTGCAGTCTGTGG + Intronic
1056328842 9:85504998-85505020 GGCTTCAGCCCAGGAGTTTGAGG - Intergenic
1060796261 9:126514629-126514651 GGGCCCGGCCCCGCAGTCTATGG - Intergenic
1062253090 9:135608130-135608152 GGCTGTGGCCCCGCAGCATGGGG + Intergenic
1203785383 EBV:124674-124696 GGCCTCGGCCCTACAGTTTGGGG - Intergenic
1189747151 X:44180841-44180863 TGCTTCAGCCCAGCAGTTTGAGG + Intronic
1190887972 X:54545930-54545952 GGCTTGAGCCCAGCAGTTTGAGG - Intronic
1199936168 X:152575708-152575730 GGCTTAAGCTCCCCAGTCTGTGG - Intergenic
1200251615 X:154557153-154557175 GGCTTCGGCCCCGCAGTCTGTGG - Intronic
1200253822 X:154568837-154568859 GGCTTCGGCCCCGCAGTCTGTGG - Intergenic
1200263947 X:154635571-154635593 GGCTTCGGCCCCGCAGTCTGTGG + Intergenic
1200266152 X:154647263-154647285 GGCTTCGGCCCCGCAGTCTGTGG + Intergenic