ID: 1200251617

View in Genome Browser
Species Human (GRCh38)
Location X:154557168-154557190
Sequence GCCACGCGTTTCTGTGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 4, 1: 0, 2: 0, 3: 5, 4: 60}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200251617_1200251629 22 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251629 X:154557213-154557235 GGCTGAGCTAGCGGTGGTGTCGG 0: 4
1: 0
2: 0
3: 5
4: 155
1200251617_1200251628 16 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251628 X:154557207-154557229 CCTGGAGGCTGAGCTAGCGGTGG 0: 4
1: 0
2: 1
3: 40
4: 762
1200251617_1200251620 -7 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251620 X:154557184-154557206 GCGTGGCCTCCCGCTTCTGGAGG 0: 4
1: 0
2: 1
3: 8
4: 113
1200251617_1200251619 -10 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40
1200251617_1200251631 27 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251631 X:154557218-154557240 AGCTAGCGGTGGTGTCGGCAGGG 0: 4
1: 0
2: 0
3: 2
4: 58
1200251617_1200251623 1 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251623 X:154557192-154557214 TCCCGCTTCTGGAGGCCTGGAGG 0: 4
1: 0
2: 3
3: 15
4: 225
1200251617_1200251630 26 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251630 X:154557217-154557239 GAGCTAGCGGTGGTGTCGGCAGG 0: 4
1: 0
2: 0
3: 8
4: 62
1200251617_1200251621 -2 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251621 X:154557189-154557211 GCCTCCCGCTTCTGGAGGCCTGG 0: 4
1: 0
2: 2
3: 28
4: 286
1200251617_1200251626 13 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251626 X:154557204-154557226 AGGCCTGGAGGCTGAGCTAGCGG 0: 4
1: 0
2: 1
3: 37
4: 444
1200251617_1200251632 30 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251632 X:154557221-154557243 TAGCGGTGGTGTCGGCAGGGTGG 0: 4
1: 0
2: 0
3: 7
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200251617 Original CRISPR GCCACGCGTTTCTGTGGCTT CGG (reversed) Intronic
902468337 1:16631450-16631472 GCCTCGCCTTTCGGTGGCTTCGG - Intergenic
902771419 1:18647333-18647355 GGCACGCGGCTCTGTGGCTCAGG + Intronic
903070835 1:20726335-20726357 GCCACTCATTTGTGTGACTTGGG + Intronic
903154788 1:21436208-21436230 GCCACGCCTTTCGGTGGCCTGGG + Intergenic
904009055 1:27379720-27379742 GGCCCGCGTTTCTGTGGCTGTGG - Exonic
912490408 1:110059682-110059704 GCCTAGGGTCTCTGTGGCTTTGG - Intronic
915142468 1:153776027-153776049 GCCCAGAGTTTCTGTGGCTCTGG + Exonic
919876101 1:201869874-201869896 GCCAAGCATTTCTGGTGCTTTGG + Intronic
1068104635 10:52598702-52598724 TCCAAGTGTTTCTGTGGCTTTGG + Intergenic
1077238836 11:1500051-1500073 GCCACTCCTGTCTGTGGCTGAGG - Intronic
1083691209 11:64409933-64409955 GCCACACTTTCCAGTGGCTTAGG + Intergenic
1087070740 11:94077810-94077832 GCCAAGCTTGTCTTTGGCTTTGG + Intronic
1096580184 12:52579986-52580008 GCCTAGCTTTTCTCTGGCTTGGG + Intergenic
1099944266 12:89225911-89225933 GCCACTCCTTTCTCTGGTTTGGG + Intergenic
1102303733 12:111789616-111789638 CCCAGGCGATTCTGAGGCTTGGG + Intronic
1103389787 12:120563700-120563722 GCCACTAGATCCTGTGGCTTGGG + Intronic
1103407483 12:120686473-120686495 GCCACGCGTTTCCGCTGCGTTGG + Intergenic
1108061673 13:46539224-46539246 TCCATGTCTTTCTGTGGCTTGGG + Intergenic
1113657275 13:112075018-112075040 GAGACTCGTTTCTGTGTCTTAGG - Intergenic
1115127408 14:30012903-30012925 CCCACCCTTTTCTGTGGCCTAGG - Intronic
1119687607 14:76645079-76645101 GCCTCATGTTTCTGCGGCTTGGG - Intergenic
1122738252 14:103856016-103856038 GACACTCTTTTCTGTGGCCTGGG - Intergenic
1124085437 15:26545772-26545794 GCCAGGGATTTCTTTGGCTTTGG - Exonic
1125756135 15:42066233-42066255 GCCACACCTCTCTGTGTCTTTGG - Intergenic
1128760165 15:70211195-70211217 TCCAGGTCTTTCTGTGGCTTGGG - Intergenic
1131779457 15:95840886-95840908 GCTATGCTTTTCTGTGTCTTTGG - Intergenic
1135027297 16:19008275-19008297 GCCAAGCTTTGCTGTGTCTTGGG - Intronic
1139442922 16:66977732-66977754 GCCACGCCTGTCTGAGTCTTTGG - Intergenic
1140638811 16:76947934-76947956 GGGATGGGTTTCTGTGGCTTTGG - Intergenic
1142131837 16:88434739-88434761 GGGAGGCATTTCTGTGGCTTTGG - Exonic
1143519141 17:7435854-7435876 GCCATGCGGTTCTATCGCTTTGG - Exonic
1147684815 17:42280702-42280724 GCCACGCCATTCTGAGGCCTTGG - Intergenic
1150445348 17:65224061-65224083 GCCAGGCTTTGATGTGGCTTGGG + Intronic
1160480402 18:79234743-79234765 ACCATGGGTTTGTGTGGCTTAGG + Intronic
928942397 2:36739832-36739854 CCCACGGCTCTCTGTGGCTTTGG + Intronic
930828768 2:55720451-55720473 GGCACGGCTTTCTCTGGCTTTGG + Intergenic
931974363 2:67626900-67626922 GCCTGGCATTCCTGTGGCTTTGG + Intergenic
938069963 2:128303098-128303120 GCCAGGCTTTTCTGGGGCCTGGG + Intronic
940849112 2:158671751-158671773 TCCACGCGTTTCTGTTCGTTTGG - Intronic
1174480849 20:50830331-50830353 GCCACGCATTTCTGTCAGTTTGG - Exonic
1174520723 20:51128542-51128564 CCCAGGACTTTCTGTGGCTTCGG - Intergenic
1183688439 22:39375145-39375167 GCCTCGCTGTTCTGAGGCTTGGG + Intronic
954149927 3:48652279-48652301 GTCAAGCCTTTCTGTGGCATTGG - Intronic
954214252 3:49115728-49115750 GCCAGGTGTGTCTCTGGCTTTGG + Exonic
955209267 3:56925817-56925839 GCCAGGCTGTCCTGTGGCTTTGG - Intronic
965144864 3:164889082-164889104 GCCACGCCATTATGGGGCTTGGG - Intergenic
968736029 4:2296998-2297020 GCCATGCGGTGCTGTGGCCTCGG - Intronic
980299664 4:130972643-130972665 GCCACACGTTTCTGTTTTTTTGG - Intergenic
986525178 5:8665654-8665676 GCAACTCTTTTCTGTTGCTTGGG - Intergenic
989279979 5:39629591-39629613 GCAATGCCTTTCTTTGGCTTTGG + Intergenic
1014913113 6:127117616-127117638 CCAAGGCTTTTCTGTGGCTTTGG - Intergenic
1019702096 7:2478937-2478959 GCCACTGGGTGCTGTGGCTTGGG + Intergenic
1024615719 7:51109846-51109868 GCCACATGTTTCCGTGGCTGAGG + Intronic
1034071827 7:148193656-148193678 GCCATGCTGTTCTCTGGCTTGGG + Intronic
1034330873 7:150281208-150281230 GCCGCGCATTCCTGTGTCTTAGG - Intronic
1034791756 7:153976915-153976937 GCCACGCGGCTCTGTGGCCTGGG + Intronic
1041401644 8:57451380-57451402 TCCAGATGTTTCTGTGGCTTTGG - Intergenic
1044417564 8:91953576-91953598 GCCACACATTGCTGTGACTTTGG + Intergenic
1057723689 9:97553755-97553777 GCCTCTGGTTTCTTTGGCTTGGG + Intronic
1057818543 9:98314021-98314043 GCTAAGGCTTTCTGTGGCTTGGG - Intronic
1061248763 9:129414546-129414568 GCCTCGCGTGTCTGAGGCTGGGG + Intergenic
1187531716 X:20103108-20103130 GCCACGGGGTTCTCTGGCCTAGG + Intronic
1195069059 X:101262198-101262220 ACCACAGGTTTCTGTTGCTTTGG - Exonic
1196510333 X:116502671-116502693 GCCAACCCTTTCTGTGGCTATGG + Intergenic
1198560256 X:137842161-137842183 GTCACACGTTTTTCTGGCTTTGG + Intergenic
1200251617 X:154557168-154557190 GCCACGCGTTTCTGTGGCTTCGG - Intronic
1200253824 X:154568852-154568874 GCCACGCGTTTCTGTGGCTTCGG - Intergenic
1200263945 X:154635556-154635578 GCCACGCGTTTCTGTGGCTTCGG + Intergenic
1200266150 X:154647248-154647270 GCCACGCGTTTCTGTGGCTTCGG + Intergenic