ID: 1200251619

View in Genome Browser
Species Human (GRCh38)
Location X:154557181-154557203
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 4, 1: 0, 2: 0, 3: 3, 4: 40}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200251614_1200251619 12 Left 1200251614 X:154557146-154557168 CCAAGCACCACAGACTGCGGGGC 0: 4
1: 0
2: 2
3: 25
4: 206
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40
1200251610_1200251619 18 Left 1200251610 X:154557140-154557162 CCGTGACCAAGCACCACAGACTG 0: 4
1: 2
2: 40
3: 352
4: 1420
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40
1200251615_1200251619 5 Left 1200251615 X:154557153-154557175 CCACAGACTGCGGGGCCGAAGCC 0: 4
1: 0
2: 0
3: 17
4: 175
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40
1200251617_1200251619 -10 Left 1200251617 X:154557168-154557190 CCGAAGCCACAGAAACGCGTGGC 0: 4
1: 0
2: 0
3: 5
4: 60
Right 1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG 0: 4
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905379891 1:37554300-37554322 AACTCCTGGACTTCCGCTTCCGG + Exonic
908128447 1:61052066-61052088 AAAGCGAGCCCTCCCGCTCCCGG + Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
915190111 1:154142805-154142827 AACCTCTGCCCTCCCGCTTCAGG - Intronic
917817333 1:178724884-178724906 ACCGCCTGGCCACCCGCTCCCGG - Intergenic
920357062 1:205381610-205381632 CAAGCGAGGCCTCCTGCTTCAGG - Exonic
1076165880 10:128282177-128282199 AACGCATGGCCTGCTGCTCCTGG + Intergenic
1103909986 12:124346770-124346792 GAGGCGTGCCCTCCCGCTTTAGG + Exonic
1104670151 12:130674860-130674882 AACACGTGGCCTTCCGGGTCCGG + Intronic
1122666368 14:103333472-103333494 AGCGCGTCGCCTCCCGTTTTCGG - Intergenic
1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG + Intronic
1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG + Exonic
1142351388 16:89582424-89582446 AAGGAGTGGCCTCCCCTTTCTGG - Intronic
1144653340 17:17020368-17020390 ACCGCATGGCCACCAGCTTCAGG + Intergenic
1148680829 17:49472631-49472653 AAGGCGTGGCCACCCCCTCCTGG - Intronic
1148859964 17:50599658-50599680 AACTCTTGGCCTCCCGCTCCAGG - Exonic
1160168008 18:76530656-76530678 AACGCCTGGCCTCCTGCCTCAGG - Intergenic
1161939764 19:7395113-7395135 CTCGCGCGGCTTCCCGCTTCCGG + Intronic
1167469943 19:49670128-49670150 GAGGCGTGGCTTCCCGGTTCAGG - Intronic
1167487384 19:49770712-49770734 AACACGTGGCCTCCTGTGTCTGG - Intronic
934683739 2:96305561-96305583 AACGGGTTCCCTTCCGCTTCCGG + Intergenic
1175625622 20:60486349-60486371 AACGGTTGGACTCCCGCTTTTGG + Intergenic
1182555600 22:31126899-31126921 GCCACGTGGCCTCCCGCTGCAGG + Exonic
1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG + Intronic
1183828364 22:40405401-40405423 AAGGAGTGGCCTCCCACTCCGGG + Intronic
950040910 3:9918446-9918468 AAGGCCTGGCCTGCCGCTCCTGG + Intronic
982105861 4:152011662-152011684 AACACGTGGCCACCTTCTTCCGG + Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
999205949 5:149848170-149848192 AAAGCGCGGCCTGCCGTTTCCGG + Exonic
1005454182 6:26003270-26003292 AACCCGAGGCCTCCCTCTGCTGG + Intergenic
1006152155 6:31995378-31995400 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1006158457 6:32028116-32028138 GAGGCGTGGCCTCCCTCTTGAGG + Exonic
1009623487 6:66105603-66105625 AAGGCGTGGCCTGACGCTCCTGG + Intergenic
1018226188 6:161631004-161631026 AAAGCGTGGCCCCACCCTTCTGG - Intronic
1019883316 7:3882400-3882422 AAAGAGGGGCCTCCCGCATCAGG - Intronic
1022648706 7:32255418-32255440 AACACTTGGCCTCTGGCTTCAGG + Intronic
1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG + Intergenic
1033055002 7:138043436-138043458 AATGCTTGGACTTCCGCTTCTGG + Intronic
1034982416 7:155487606-155487628 GACGCGGGGTCTCCCGCTGCGGG - Intronic
1049184526 8:141242775-141242797 AACGTGTGGCCTCCAGTCTCGGG - Intronic
1057518819 9:95744489-95744511 ACCTCGTTGCCTCCCTCTTCTGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic