ID: 1200253667

View in Genome Browser
Species Human (GRCh38)
Location X:154567798-154567820
Sequence CTCCTCCGGTAGCACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200253652_1200253667 13 Left 1200253652 X:154567762-154567784 CCCACCGCCCTGCCCGGAGGTGG No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253658_1200253667 6 Left 1200253658 X:154567769-154567791 CCCTGCCCGGAGGTGGGGCTGCC No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253659_1200253667 5 Left 1200253659 X:154567770-154567792 CCTGCCCGGAGGTGGGGCTGCCT No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253654_1200253667 12 Left 1200253654 X:154567763-154567785 CCACCGCCCTGCCCGGAGGTGGG No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253660_1200253667 1 Left 1200253660 X:154567774-154567796 CCCGGAGGTGGGGCTGCCTCCTC No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253657_1200253667 9 Left 1200253657 X:154567766-154567788 CCGCCCTGCCCGGAGGTGGGGCT No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253649_1200253667 30 Left 1200253649 X:154567745-154567767 CCAGGCATTGGTCTAGACCCACC No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data
1200253661_1200253667 0 Left 1200253661 X:154567775-154567797 CCGGAGGTGGGGCTGCCTCCTCC No data
Right 1200253667 X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200253667 Original CRISPR CTCCTCCGGTAGCACAGTGT AGG Intergenic
No off target data available for this crispr