ID: 1200253826

View in Genome Browser
Species Human (GRCh38)
Location X:154568865-154568887
Sequence AACGCGTGGCCTCCCGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200253824_1200253826 -10 Left 1200253824 X:154568852-154568874 CCGAAGCCACAGAAACGCGTGGC No data
Right 1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG No data
1200253817_1200253826 18 Left 1200253817 X:154568824-154568846 CCGTGACCAAGCACCACAGACTG No data
Right 1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG No data
1200253822_1200253826 5 Left 1200253822 X:154568837-154568859 CCACAGACTGCGGGGCCGAAGCC No data
Right 1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG No data
1200253816_1200253826 28 Left 1200253816 X:154568814-154568836 CCTGGGGCTGCCGTGACCAAGCA No data
Right 1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG No data
1200253821_1200253826 12 Left 1200253821 X:154568830-154568852 CCAAGCACCACAGACTGCGGGGC No data
Right 1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200253826 Original CRISPR AACGCGTGGCCTCCCGCTTC TGG Intergenic