ID: 1200254248

View in Genome Browser
Species Human (GRCh38)
Location X:154571113-154571135
Sequence CTGTCACCATAAATGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200254243_1200254248 17 Left 1200254243 X:154571073-154571095 CCATCAGGATTTCTCTGTCAATA No data
Right 1200254248 X:154571113-154571135 CTGTCACCATAAATGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200254248 Original CRISPR CTGTCACCATAAATGGTGCT TGG Intergenic
No off target data available for this crispr