ID: 1200257185

View in Genome Browser
Species Human (GRCh38)
Location X:154589428-154589450
Sequence CTCAGTAAGGGGAATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200257185_1200257192 24 Left 1200257185 X:154589428-154589450 CCTGCCACATTCCCCTTACTGAG No data
Right 1200257192 X:154589475-154589497 TACTGAGGGAACTCAGAGACCGG 0: 87
1: 131
2: 442
3: 108
4: 206
1200257185_1200257191 10 Left 1200257185 X:154589428-154589450 CCTGCCACATTCCCCTTACTGAG No data
Right 1200257191 X:154589461-154589483 TAGTAATCAATAAATACTGAGGG 0: 35
1: 112
2: 304
3: 232
4: 564
1200257185_1200257190 9 Left 1200257185 X:154589428-154589450 CCTGCCACATTCCCCTTACTGAG No data
Right 1200257190 X:154589460-154589482 ATAGTAATCAATAAATACTGAGG 0: 37
1: 115
2: 309
3: 279
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200257185 Original CRISPR CTCAGTAAGGGGAATGTGGC AGG (reversed) Intergenic
No off target data available for this crispr