ID: 1200259598

View in Genome Browser
Species Human (GRCh38)
Location X:154606028-154606050
Sequence TGATGCTCTCAGAGTCATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200259594_1200259598 -10 Left 1200259594 X:154606015-154606037 CCGGTTCCCCAGCTGATGCTCTC No data
Right 1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG No data
1200259590_1200259598 29 Left 1200259590 X:154605976-154605998 CCTCCTTCCAAACAATGCACGTC No data
Right 1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG No data
1200259592_1200259598 22 Left 1200259592 X:154605983-154606005 CCAAACAATGCACGTCTGCTGTG No data
Right 1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG No data
1200259591_1200259598 26 Left 1200259591 X:154605979-154606001 CCTTCCAAACAATGCACGTCTGC No data
Right 1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200259598 Original CRISPR TGATGCTCTCAGAGTCATCT CGG Intergenic
No off target data available for this crispr