ID: 1200260585

View in Genome Browser
Species Human (GRCh38)
Location X:154614974-154614996
Sequence CTCAGTAAGGGGAATGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200260579_1200260585 10 Left 1200260579 X:154614941-154614963 CCCTCAGTATTTATTGATTACTA 0: 35
1: 112
2: 304
3: 232
4: 564
Right 1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG No data
1200260578_1200260585 24 Left 1200260578 X:154614927-154614949 CCGGTCTCTGAGTTCCCTCAGTA 0: 87
1: 131
2: 442
3: 108
4: 206
Right 1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG No data
1200260580_1200260585 9 Left 1200260580 X:154614942-154614964 CCTCAGTATTTATTGATTACTAT 0: 37
1: 115
2: 309
3: 279
4: 449
Right 1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200260585 Original CRISPR CTCAGTAAGGGGAATGTGGC AGG Intergenic
No off target data available for this crispr