ID: 1200263521

View in Genome Browser
Species Human (GRCh38)
Location X:154633295-154633317
Sequence CTGTCACCATAAATGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200263521_1200263526 17 Left 1200263521 X:154633295-154633317 CCAAGCACCATTTATGGTGACAG No data
Right 1200263526 X:154633335-154633357 TATTGACAGAGAAATCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200263521 Original CRISPR CTGTCACCATAAATGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr