ID: 1200263943

View in Genome Browser
Species Human (GRCh38)
Location X:154635543-154635565
Sequence AACGCGTGGCCTCCCGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200263943_1200263953 28 Left 1200263943 X:154635543-154635565 CCAGAAGCGGGAGGCCACGCGTT No data
Right 1200263953 X:154635594-154635616 TGCTTGGTCACGGCAGCCCCAGG No data
1200263943_1200263945 -10 Left 1200263943 X:154635543-154635565 CCAGAAGCGGGAGGCCACGCGTT No data
Right 1200263945 X:154635556-154635578 GCCACGCGTTTCTGTGGCTTCGG No data
1200263943_1200263952 18 Left 1200263943 X:154635543-154635565 CCAGAAGCGGGAGGCCACGCGTT No data
Right 1200263952 X:154635584-154635606 CAGTCTGTGGTGCTTGGTCACGG No data
1200263943_1200263947 5 Left 1200263943 X:154635543-154635565 CCAGAAGCGGGAGGCCACGCGTT No data
Right 1200263947 X:154635571-154635593 GGCTTCGGCCCCGCAGTCTGTGG No data
1200263943_1200263948 12 Left 1200263943 X:154635543-154635565 CCAGAAGCGGGAGGCCACGCGTT No data
Right 1200263948 X:154635578-154635600 GCCCCGCAGTCTGTGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200263943 Original CRISPR AACGCGTGGCCTCCCGCTTC TGG (reversed) Intergenic