ID: 1200266565

View in Genome Browser
Species Human (GRCh38)
Location X:154649319-154649341
Sequence CTGGAGACACAGCTTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200266556_1200266565 19 Left 1200266556 X:154649277-154649299 CCCTTGAGGCCACTTGAGGGAAG No data
Right 1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG No data
1200266553_1200266565 25 Left 1200266553 X:154649271-154649293 CCTGGGCCCTTGAGGCCACTTGA No data
Right 1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG No data
1200266552_1200266565 28 Left 1200266552 X:154649268-154649290 CCTCCTGGGCCCTTGAGGCCACT No data
Right 1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG No data
1200266557_1200266565 18 Left 1200266557 X:154649278-154649300 CCTTGAGGCCACTTGAGGGAAGA No data
Right 1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG No data
1200266561_1200266565 10 Left 1200266561 X:154649286-154649308 CCACTTGAGGGAAGAGAGGGGAA No data
Right 1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200266565 Original CRISPR CTGGAGACACAGCTTCAGGA AGG Intergenic
No off target data available for this crispr