ID: 1200268473

View in Genome Browser
Species Human (GRCh38)
Location X:154659578-154659600
Sequence GCCTGAGGGACAGCAAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200268473_1200268477 -6 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268477 X:154659595-154659617 TCAGGCCTTTCAGAAGAAACTGG No data
1200268473_1200268480 3 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268480 X:154659604-154659626 TCAGAAGAAACTGGGACACTAGG No data
1200268473_1200268482 25 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268473_1200268478 -5 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268478 X:154659596-154659618 CAGGCCTTTCAGAAGAAACTGGG No data
1200268473_1200268481 4 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268481 X:154659605-154659627 CAGAAGAAACTGGGACACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200268473 Original CRISPR GCCTGAGGGACAGCAAGGCT TGG (reversed) Intergenic