ID: 1200268474

View in Genome Browser
Species Human (GRCh38)
Location X:154659583-154659605
Sequence GAAAGGCCTGAGGGACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200268474_1200268481 -1 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268481 X:154659605-154659627 CAGAAGAAACTGGGACACTAGGG No data
1200268474_1200268478 -10 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268478 X:154659596-154659618 CAGGCCTTTCAGAAGAAACTGGG No data
1200268474_1200268482 20 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268474_1200268480 -2 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268480 X:154659604-154659626 TCAGAAGAAACTGGGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200268474 Original CRISPR GAAAGGCCTGAGGGACAGCA AGG (reversed) Intergenic