ID: 1200268478

View in Genome Browser
Species Human (GRCh38)
Location X:154659596-154659618
Sequence CAGGCCTTTCAGAAGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200268471_1200268478 -2 Left 1200268471 X:154659575-154659597 CCTCCAAGCCTTGCTGTCCCTCA No data
Right 1200268478 X:154659596-154659618 CAGGCCTTTCAGAAGAAACTGGG No data
1200268474_1200268478 -10 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268478 X:154659596-154659618 CAGGCCTTTCAGAAGAAACTGGG No data
1200268473_1200268478 -5 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268478 X:154659596-154659618 CAGGCCTTTCAGAAGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200268478 Original CRISPR CAGGCCTTTCAGAAGAAACT GGG Intergenic
No off target data available for this crispr