ID: 1200268480

View in Genome Browser
Species Human (GRCh38)
Location X:154659604-154659626
Sequence TCAGAAGAAACTGGGACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200268473_1200268480 3 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268480 X:154659604-154659626 TCAGAAGAAACTGGGACACTAGG No data
1200268471_1200268480 6 Left 1200268471 X:154659575-154659597 CCTCCAAGCCTTGCTGTCCCTCA No data
Right 1200268480 X:154659604-154659626 TCAGAAGAAACTGGGACACTAGG No data
1200268474_1200268480 -2 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268480 X:154659604-154659626 TCAGAAGAAACTGGGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200268480 Original CRISPR TCAGAAGAAACTGGGACACT AGG Intergenic