ID: 1200268481

View in Genome Browser
Species Human (GRCh38)
Location X:154659605-154659627
Sequence CAGAAGAAACTGGGACACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200268475_1200268481 -10 Left 1200268475 X:154659592-154659614 CCCTCAGGCCTTTCAGAAGAAAC No data
Right 1200268481 X:154659605-154659627 CAGAAGAAACTGGGACACTAGGG No data
1200268474_1200268481 -1 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268481 X:154659605-154659627 CAGAAGAAACTGGGACACTAGGG No data
1200268471_1200268481 7 Left 1200268471 X:154659575-154659597 CCTCCAAGCCTTGCTGTCCCTCA No data
Right 1200268481 X:154659605-154659627 CAGAAGAAACTGGGACACTAGGG No data
1200268473_1200268481 4 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268481 X:154659605-154659627 CAGAAGAAACTGGGACACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200268481 Original CRISPR CAGAAGAAACTGGGACACTA GGG Intergenic