ID: 1200268482

View in Genome Browser
Species Human (GRCh38)
Location X:154659626-154659648
Sequence GGTCCCATTCCGCAGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200268479_1200268482 3 Left 1200268479 X:154659600-154659622 CCTTTCAGAAGAAACTGGGACAC No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268475_1200268482 11 Left 1200268475 X:154659592-154659614 CCCTCAGGCCTTTCAGAAGAAAC No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268474_1200268482 20 Left 1200268474 X:154659583-154659605 CCTTGCTGTCCCTCAGGCCTTTC No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268476_1200268482 10 Left 1200268476 X:154659593-154659615 CCTCAGGCCTTTCAGAAGAAACT No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268471_1200268482 28 Left 1200268471 X:154659575-154659597 CCTCCAAGCCTTGCTGTCCCTCA No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data
1200268473_1200268482 25 Left 1200268473 X:154659578-154659600 CCAAGCCTTGCTGTCCCTCAGGC No data
Right 1200268482 X:154659626-154659648 GGTCCCATTCCGCAGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200268482 Original CRISPR GGTCCCATTCCGCAGCTGCT TGG Intergenic