ID: 1200271409

View in Genome Browser
Species Human (GRCh38)
Location X:154688048-154688070
Sequence ATTTCCTTCTAAAAGAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200271409_1200271411 4 Left 1200271409 X:154688048-154688070 CCATAATTCTTTTAGAAGGAAAT 0: 1
1: 0
2: 5
3: 53
4: 591
Right 1200271411 X:154688075-154688097 GAGAAAATTCTAATGAACTAAGG 0: 1
1: 0
2: 1
3: 24
4: 304
1200271409_1200271412 9 Left 1200271409 X:154688048-154688070 CCATAATTCTTTTAGAAGGAAAT 0: 1
1: 0
2: 5
3: 53
4: 591
Right 1200271412 X:154688080-154688102 AATTCTAATGAACTAAGGTTAGG 0: 1
1: 0
2: 0
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200271409 Original CRISPR ATTTCCTTCTAAAAGAATTA TGG (reversed) Intronic
900006588 1:59245-59267 GTTCTCTTCTAAAAGAATTAGGG - Intergenic
901162357 1:7188278-7188300 ATTTCCTTTTAAAAGTTTAATGG - Intronic
902921789 1:19670414-19670436 ATTTCCTTCTTCTAGAATTTAGG + Intronic
905470735 1:38189833-38189855 GTTTCCTTCTAGAAGATCTAGGG + Intergenic
905950127 1:41943628-41943650 ATTCCATTCTCAAAGAAGTATGG - Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907805099 1:57810924-57810946 ATTTCCTTCTGGAAGATCTAGGG + Intronic
908366038 1:63424710-63424732 TTTTCCTTCTAAGAGTTTTATGG + Intronic
908547853 1:65179462-65179484 ATTTCCTTATCTAAGAAATAGGG + Intronic
908860701 1:68484337-68484359 ATATCATTTTAAAAGCATTAGGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909637384 1:77831996-77832018 ATTTCCTTCTAAAATTAATTGGG + Intronic
909948250 1:81688653-81688675 ATTTACTTGAAAAAGAATTCAGG - Intronic
910071729 1:83223318-83223340 ATTTCCTACTATATGAACTAGGG - Intergenic
910736960 1:90469881-90469903 TTTTCCTTTTAAAACAATTCTGG - Intergenic
911321663 1:96420992-96421014 ATTTCTTTATAAAAGCATTTCGG - Intergenic
911473097 1:98342513-98342535 ATATGCTTCTAAAAGCATTCTGG + Intergenic
912106465 1:106283026-106283048 ATATTTTTCCAAAAGAATTAGGG + Intergenic
913130110 1:115831388-115831410 ATTTGCTTCAAAAAGTCTTAAGG - Intergenic
913975838 1:143454322-143454344 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
914070232 1:144279941-144279963 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
914108923 1:144686413-144686435 ATTTCCTTCTAGGAGTTTTATGG + Intergenic
915610794 1:156990884-156990906 ATTTCCTGCTAAAAGGAACAGGG - Intronic
915810104 1:158900031-158900053 ATTTCCTTCTCAAAGAATACAGG + Intergenic
916483597 1:165236960-165236982 GTTTCCTTCTACAAGAATGTAGG + Intronic
916925235 1:169512458-169512480 AATTCCTTCTTAAAAAATAAAGG + Intergenic
916969075 1:169990007-169990029 ATATTCTTCTAACAAAATTATGG + Intronic
917528097 1:175807472-175807494 TTTTCCTTGCCAAAGAATTATGG - Intergenic
918247931 1:182676399-182676421 AATTGCTTTTAAAAGATTTACGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918673249 1:187247830-187247852 GTTTTCTTCTAGAAGTATTATGG - Intergenic
918724696 1:187905172-187905194 ATTTGCTACAAAAAGAACTATGG - Intergenic
919401121 1:197118556-197118578 ATTGCCTTCTAACATAACTAGGG - Intronic
920024862 1:202986851-202986873 GTTTCCTTTTAAAGGATTTAAGG + Intergenic
920752089 1:208688230-208688252 CTTGCTTTCTAAAATAATTAAGG - Intergenic
920974042 1:210768954-210768976 TTGTTGTTCTAAAAGAATTATGG + Intronic
921341009 1:214134720-214134742 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
921616025 1:217268792-217268814 ATTTTCTTCTGAGAGATTTAAGG + Intergenic
921808448 1:219482085-219482107 ATTTAATTATAAAGGAATTAGGG - Intergenic
922002484 1:221494168-221494190 ATTTTATCCAAAAAGAATTATGG - Intergenic
922634585 1:227154636-227154658 ATTTGCTCCTAAACGACTTATGG - Intronic
922903085 1:229153218-229153240 ATTTTATTCTAATACAATTAGGG + Intergenic
923230188 1:231978815-231978837 GTTTCCTACTAAAAGAAACACGG - Intronic
923994264 1:239474352-239474374 ATTTACTTGTAACAGAGTTATGG - Intronic
924083727 1:240426650-240426672 ATTTCCTTCAAAAACAATATGGG - Intronic
1063264257 10:4429482-4429504 AAGTCATTTTAAAAGAATTAAGG - Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063643655 10:7856650-7856672 ATTTCCCTCTAAAAGGAACAAGG + Intronic
1063777992 10:9285999-9286021 GTTTACTTTTAAAAGAAATAGGG - Intergenic
1063790373 10:9438511-9438533 TTTTCATTTTAAAAGGATTATGG + Intergenic
1064296830 10:14086497-14086519 ATTTCCCACTAACAGAATTGGGG + Intronic
1064405092 10:15054439-15054461 ACTTCCTTCTGCAAGAATTGAGG + Intronic
1065456811 10:25915367-25915389 TTTTCCTTCTAACAGTCTTATGG - Intergenic
1066116667 10:32246686-32246708 TTGTCCATTTAAAAGAATTAAGG - Intergenic
1066627463 10:37422114-37422136 ATTGCCTCTCAAAAGAATTATGG - Intergenic
1066666032 10:37783403-37783425 ATTTTCTTCTTAAAGTATTATGG - Intronic
1067021330 10:42801096-42801118 ATTTCCTACTAAAAGAAATCAGG - Intronic
1068070792 10:52192312-52192334 ATTTCTGGCTAAAAGAAATAAGG - Intronic
1068634384 10:59332371-59332393 ATTTCATTTTAAAACATTTAAGG + Intronic
1069086478 10:64145616-64145638 ATTTCCTTTTAGAAGAATTTAGG + Intergenic
1069242595 10:66162185-66162207 ATTTACTTGAAAAAGAATTCAGG - Intronic
1070205005 10:74249432-74249454 ATTTCTTTCTGAAAGTCTTAAGG - Intronic
1070652178 10:78245354-78245376 CTTTCCTTCCAAAACAATTTAGG - Intergenic
1070996564 10:80788729-80788751 AGTTTCTTCTAGAAGAATGAGGG + Intergenic
1073012399 10:100371640-100371662 ATTTCTTTCTTAGAGAATTATGG + Intergenic
1073049506 10:100658429-100658451 ACTTCCTTCTAAGAGAGATAAGG + Intergenic
1073581480 10:104670309-104670331 ATTTTCTTCTAAGAGCATTATGG + Intronic
1073934778 10:108618330-108618352 TTTTCCTTCTAAAATTTTTATGG + Intergenic
1074155889 10:110799116-110799138 CTTTCCTTATAAAAAAATTCAGG - Intronic
1074807968 10:117072869-117072891 ATTTACTTGAAAAAGAATTTAGG + Intronic
1075301874 10:121332094-121332116 ATTTCCTTCTATAAGTTTCATGG + Intergenic
1075319866 10:121482486-121482508 TTTTCCTTCTAAAATACTTGGGG + Intronic
1076467639 10:130695883-130695905 ATTTCTTGATAAAACAATTAGGG - Intergenic
1076472823 10:130731005-130731027 AGTTAATTCTAAAAGAATGAAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078397741 11:10996313-10996335 AGATCCTTCAAAAACAATTATGG - Intergenic
1079640832 11:22803286-22803308 GTTTTCTTCTGAAATAATTAGGG + Intronic
1079984509 11:27186669-27186691 ATTTTCTTCTAAAATGTTTAAGG + Intergenic
1080238537 11:30099717-30099739 ATTTCCTTCTAGAAGTAACATGG + Intergenic
1080510238 11:32962611-32962633 ATTTTCTTCTAAGAGTTTTATGG + Intronic
1080858369 11:36131578-36131600 TTTGCCTTTTAAAAAAATTATGG + Intronic
1081207132 11:40289608-40289630 ATGTACTTTTCAAAGAATTAGGG - Intronic
1081834214 11:46140553-46140575 ATTACATTTTAAAAGAATTTGGG - Intergenic
1082126649 11:48439799-48439821 ATTGCCATTTAAAAAAATTATGG + Intergenic
1082250369 11:49972548-49972570 ATTGCCATTTAAAAAAATTATGG - Intergenic
1082687894 11:56261740-56261762 GTTTTCTTCTAAAAGTTTTATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083074861 11:60026242-60026264 ATTTTCTTCTAGAAGTTTTATGG + Intergenic
1083905558 11:65667493-65667515 ATTTCCTACTAAGAGAAATCAGG - Intergenic
1085076267 11:73595821-73595843 ATTTTCTTCCAAAGGAATTCAGG - Intronic
1086434193 11:86765075-86765097 ATCTGGTTTTAAAAGAATTAAGG - Intergenic
1086747309 11:90445707-90445729 ATTTCCTTCTACATAAAATACGG + Intergenic
1087126337 11:94629707-94629729 ATTATTTTCTAAAAGAATGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087327451 11:96741034-96741056 TTTTCCTTTTGAAAGAACTAAGG + Intergenic
1087422357 11:97945580-97945602 ATTTTCTTCCAAGAGATTTATGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1087580507 11:100045690-100045712 ATGTACATCTAAAAGAATTTAGG - Intronic
1088536245 11:110865339-110865361 ATCTCCTTCTAAAAGAATAAGGG - Intergenic
1088763947 11:112958843-112958865 ATATCCTGTTAAAAGAATTTGGG + Intergenic
1088787984 11:113200066-113200088 ATATCCTTCTCAAAGCAGTAAGG + Intronic
1088804186 11:113336484-113336506 ATTTTCTTCTAAAAGTTTTATGG + Intronic
1089036241 11:115395896-115395918 ATTTCTTTAAAAAAGAAATACGG - Intronic
1089415223 11:118283329-118283351 ATTTCCCACTAAAAGAAATCAGG - Intergenic
1089746839 11:120623548-120623570 ATTTCCTACTGAAAGAAATCAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090551076 11:127820760-127820782 AGTTCATCCTAAAAGAATTGGGG - Intergenic
1091894975 12:4094914-4094936 ATTTTCTTCATAAAGAATCATGG - Intergenic
1092035596 12:5332064-5332086 ATTTCCCTCCAATTGAATTAAGG - Intergenic
1092373065 12:7933222-7933244 ATTTCCTTCCTAGAGAATCAAGG + Intronic
1093225643 12:16479998-16480020 GTTTCCTTCTAGAAGTGTTATGG - Intronic
1093339654 12:17957025-17957047 GTTTTCTTCTAAAAGTTTTATGG - Intergenic
1095332334 12:40981826-40981848 TTTTCCATCTTAAAGAATTCTGG - Intronic
1096662423 12:53134948-53134970 ATTTTCTTCTAAGAGTTTTATGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097297817 12:57985930-57985952 TTTTCCTTATCAAACAATTATGG + Intergenic
1098151274 12:67549184-67549206 ATTTTCTTCTAAAACTGTTATGG + Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1098607387 12:72408229-72408251 CTTTCCTTATGAATGAATTAAGG - Intronic
1098619468 12:72576305-72576327 ATTTTCTTCTAAGATAATCAGGG + Intronic
1098945885 12:76589107-76589129 ATTTCCTTTTCTTAGAATTAAGG - Intergenic
1099141449 12:78981424-78981446 TATTCATTTTAAAAGAATTAAGG - Intronic
1099147176 12:79061202-79061224 ATTTCCTTCTTATTGACTTAAGG - Intronic
1099777315 12:87150656-87150678 ATTTACCTGAAAAAGAATTAAGG - Intergenic
1100109630 12:91223827-91223849 ATTTCCCTCTGAGAGAATTTGGG - Intergenic
1100782797 12:98047258-98047280 ATATGCTTCTTAAAGAATGAGGG - Intergenic
1100970435 12:100063946-100063968 ATTTACTTGAAAAAGAATTCAGG + Intronic
1101035165 12:100698552-100698574 ATCACCTTCTCAAAGAAGTAAGG + Intergenic
1101164979 12:102020114-102020136 GTTTCCTTTTAAATGAACTATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101453476 12:104804991-104805013 AATTCCTTAAAAAAAAATTAAGG + Exonic
1103083958 12:118047111-118047133 ACTTTATTCCAAAAGAATTAAGG + Intronic
1103808716 12:123595564-123595586 ACTGACTTCTAAAAAAATTAAGG - Intronic
1104294216 12:127497061-127497083 TTTTCCATCCAACAGAATTATGG + Intergenic
1105223399 13:18355417-18355439 ATTTCCTTCTAGGAGTTTTATGG + Intergenic
1105436618 13:20384406-20384428 ATTTCCTTCTAAATGCTTCATGG + Intergenic
1105750344 13:23417662-23417684 ACTTCCTTCTAAAATTTTTAAGG - Intronic
1106294998 13:28404717-28404739 TTTTCTTTTTAAAAGAATCATGG + Intronic
1106740167 13:32632099-32632121 ATTTTCTTCTAAAAGTATACAGG - Intronic
1107050512 13:36042854-36042876 TTTTCTTTCTAAATGAATTCTGG + Intronic
1107999761 13:45895427-45895449 ACTTCCTTCTGAAAGCATTAAGG + Intergenic
1108638451 13:52359499-52359521 AATTCCTTCTAAAATATTAAAGG - Intergenic
1109128687 13:58551977-58551999 ACTTGCTTCTAAAGGATTTAAGG - Intergenic
1109508304 13:63336247-63336269 ATTTACTTGAAAAAGAATTCAGG - Intergenic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1110151228 13:72256668-72256690 ATTTTGTTTGAAAAGAATTATGG - Intergenic
1110258832 13:73462322-73462344 ATTTCATTGTTAAAGAATTTTGG + Intergenic
1110313447 13:74077385-74077407 ATTCTATACTAAAAGAATTATGG + Intronic
1110756729 13:79183740-79183762 ATTTACCTTTAAAAAAATTAAGG + Intergenic
1111112042 13:83724866-83724888 GTTCCCTTCTCAAAAAATTATGG - Intergenic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1111177559 13:84616649-84616671 ATTTAATTTTAAAAGTATTAAGG + Intergenic
1111217349 13:85161668-85161690 ATTTACTTCTACTAGAAGTAAGG + Intergenic
1111750659 13:92327727-92327749 ATTTCGTTGTAAAAGAAATTGGG - Intronic
1111826885 13:93279071-93279093 TTTTCTTTCTAAGATAATTATGG + Intronic
1111955671 13:94755273-94755295 TTTTGCTTTTAAATGAATTATGG + Intergenic
1112179117 13:97059428-97059450 ATTTACTGCTAAAATAATCAGGG + Intergenic
1112832965 13:103476513-103476535 ACTTCATTATAAAAGAGTTAAGG - Intergenic
1112951446 13:105002033-105002055 GTTTTCTCCTAAATGAATTATGG + Intergenic
1113124507 13:106961728-106961750 ATTTGCTTATAAAATATTTAAGG + Intergenic
1113418048 13:110146421-110146443 ATTTTCTTCTCAAAGTTTTATGG - Intergenic
1114683382 14:24505959-24505981 ATCTCCTTCTAAGAGCATTCTGG + Intronic
1114825951 14:26079801-26079823 ATTTACTTTTAAAAGTATTCCGG - Intergenic
1114863386 14:26555287-26555309 AATTCCTTTTAAATAAATTAAGG + Intronic
1115006366 14:28490049-28490071 ATGTCCATCCAAAAGAATGATGG + Intergenic
1115253800 14:31377153-31377175 ATTTCCTACAAAAGGAATCAAGG + Intronic
1115291025 14:31772874-31772896 CTTTCTTTCTAAAAGAAAAAAGG - Intronic
1115299368 14:31866311-31866333 ATTTACCTGTAAAAGAATTCAGG + Intergenic
1115795796 14:36934135-36934157 ACTTCTTTCTAAAACAATTTGGG - Intronic
1116721917 14:48507863-48507885 AAATCCTTCTAAATGATTTAGGG - Intergenic
1117806267 14:59494095-59494117 ATTTTCTTCTAAAAATTTTAAGG - Intronic
1119517876 14:75262550-75262572 AATTCCTTCTAAAAAAAAAAAGG + Intronic
1119542353 14:75448732-75448754 TCTTCCTTCTAAAACAATGAAGG - Intronic
1119562308 14:75600615-75600637 GTTTCCTTCTAAGAGTCTTATGG - Intronic
1120195249 14:81475059-81475081 AGTTCCTTCTAAAGGAAGTGTGG + Exonic
1122273945 14:100581613-100581635 ATTTTCTGCTAAAAGAAGCAGGG + Intronic
1123166610 14:106331046-106331068 ATTTCCTGCAAAAAGAAGAAAGG - Intergenic
1123169294 14:106356085-106356107 ATTTCCTGCAAAAAGAAGAAAGG - Intergenic
1124228039 15:27913321-27913343 ATTTTCTTTTGAAAGAATTTTGG - Intronic
1124698298 15:31886893-31886915 ATTTCTTTTTAAAAGATTTCTGG + Intergenic
1124960826 15:34392776-34392798 CTTTCTTTCCAAAAGAATAAAGG - Intronic
1124977455 15:34538997-34539019 CTTTCTTTCCAAAAGAATAACGG - Intronic
1126222475 15:46230321-46230343 ATTTGCTTCTAAAAGCAATGGGG + Intergenic
1126693626 15:51307702-51307724 ATTTCCTTCTCATGGAAATAGGG + Intronic
1126832047 15:52617857-52617879 ATTTGGATTTAAAAGAATTATGG - Intronic
1127105254 15:55607043-55607065 ATTTTCTTCTAAGAGTTTTATGG + Intergenic
1127673556 15:61218711-61218733 ATTTCCTTCTACAAAAAAGATGG + Intronic
1127771834 15:62238473-62238495 GTTTTCTTCTAAAAGTTTTATGG - Intergenic
1128991588 15:72265164-72265186 ACTTCCTCCTAAAAGAAGAAGGG + Exonic
1129027664 15:72593433-72593455 ATTTTCTTCTAGAAGTTTTATGG + Exonic
1130409101 15:83629873-83629895 ATTTTCTTCCAAAAGCTTTAAGG - Intergenic
1130981828 15:88817495-88817517 ATTTCCTTTAAAAATAATAAAGG + Intronic
1132357898 15:101186381-101186403 ATTTTCTTGTAACAGAAATAAGG + Intronic
1132446933 15:101931712-101931734 GTTCTCTTCGAAAAGAATTAGGG + Intergenic
1134909770 16:18014502-18014524 AGTTCCTTCTAAAAGCTGTAAGG + Intergenic
1137790294 16:51169485-51169507 ACTTCCTTCTAATATAATGATGG + Intergenic
1137981074 16:53070347-53070369 ATTTTCTTCTAAGAGTGTTATGG + Intronic
1138080391 16:54085057-54085079 ATTTCCACCTAAAAGCATTAGGG - Intronic
1139061939 16:63263556-63263578 ATTTCCTCCTCAAAGAAATGTGG + Intergenic
1139108437 16:63857735-63857757 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1139397938 16:66655379-66655401 ATTTCCTACTAAAAGTAACAAGG + Intronic
1140177597 16:72679087-72679109 GTTTTCTTCTAAAAGGTTTACGG - Intergenic
1140286985 16:73613051-73613073 ATTTCCTTCTATTTGAATTTGGG + Intergenic
1140293075 16:73682322-73682344 ATTTTCTTATATAAAAATTAGGG + Intergenic
1140337871 16:74128086-74128108 AATTTCTTCTAAAACAATGATGG + Intergenic
1141974365 16:87505164-87505186 ATTTTCTTCTATAAAGATTATGG + Intergenic
1142927843 17:3256787-3256809 ATTTTCTTCTTAAGGAATTTGGG - Intergenic
1144122555 17:12169280-12169302 ATTTTATTCTAAAATAATTTGGG + Intergenic
1145087496 17:19954795-19954817 GTTTCCTTTTAAAAGTATTGTGG - Intronic
1146749264 17:35362988-35363010 TTTTCCTTCTCAAAGAGTCAGGG + Exonic
1147501107 17:40964572-40964594 ATTTCCTTCTTTAAGAACCAAGG + Intronic
1148723234 17:49769968-49769990 AATAACTTCTAAAAGAATTTAGG + Intronic
1149056691 17:52375431-52375453 ATTTCATTTTAAAAGCTTTATGG - Intergenic
1151071876 17:71223442-71223464 AATACCTTCTAAAAGAAGTGAGG + Intergenic
1151411597 17:73934015-73934037 CATTCCTTCTAAAAGATGTAGGG + Intergenic
1153255377 18:3165010-3165032 AGGTCCTTCTAAAAAAATTATGG - Intronic
1153465264 18:5381200-5381222 GTTTCCTGCGAAAAGAAATAGGG - Intergenic
1154163739 18:11998793-11998815 TTTTTCTTGTAAAAGAATAATGG + Intronic
1154494564 18:14945974-14945996 ATTTCCTTTTATTTGAATTAAGG + Intergenic
1155000034 18:21676928-21676950 ATTGACTTCTACATGAATTATGG - Intronic
1155285565 18:24285310-24285332 ATTTTATATTAAAAGAATTATGG - Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1155851213 18:30776690-30776712 ATTTTGTTCTCAAAGACTTAAGG + Intergenic
1156289287 18:35731771-35731793 GTTTCCTTCTAAGAGTTTTATGG - Intergenic
1156298124 18:35811012-35811034 ATTTCCTGCTAAAAGAACCCAGG + Intergenic
1156310836 18:35920291-35920313 ATTTTCTTCTACAAGTTTTATGG - Intergenic
1156328621 18:36098157-36098179 ATTTTCTTCTAAAAGTGTTATGG + Intergenic
1156567687 18:38214237-38214259 ATTTTCTTCTAGAAGATTTATGG - Intergenic
1156662974 18:39369725-39369747 GTTTCCTTCTAGAAGTTTTATGG - Intergenic
1156804985 18:41167391-41167413 AATTCCTTCTAAGTGAATGAGGG - Intergenic
1156873153 18:41971972-41971994 CCTTCCATCAAAAAGAATTAGGG - Intronic
1156898799 18:42276775-42276797 ATTTCCTTATAAATGAATACAGG + Intergenic
1157543939 18:48534642-48534664 ATTTCCTTTTGCAAGATTTAAGG - Intergenic
1157690453 18:49677647-49677669 ATTTCCTTCTTTAGAAATTATGG + Intergenic
1158040312 18:53085351-53085373 TTTTCCATCTAAAATAATTAAGG + Intronic
1158062352 18:53360796-53360818 ATTTTCTTCTACAAGCATTTAGG + Intronic
1158270216 18:55704895-55704917 AGTTCCTTCTAGAAGTTTTATGG + Intergenic
1158509987 18:58081758-58081780 ATTTTTTTCTATAATAATTAAGG - Intronic
1159221321 18:65466939-65466961 ATTTTCTTCTTAAAGGATCAGGG + Intergenic
1159498764 18:69240812-69240834 ATATTCTTCTAAAGCAATTAAGG - Intergenic
1159520889 18:69521621-69521643 GTTTTCTACTAGAAGAATTAAGG - Intronic
1160638343 19:100821-100843 GTTCTCTTCTAAAAGAATTAGGG - Intergenic
1162876828 19:13626724-13626746 ATTTGCTTCTAAAACTGTTATGG + Intergenic
1162877016 19:13627960-13627982 ATTTGCTTCTAAAACTGTTATGG + Intergenic
1163016010 19:14455123-14455145 ATTTTCTTTTAAAAAAATTATGG - Intronic
1163630638 19:18416550-18416572 ATTTTTTTCTAAGAGCATTAGGG - Intergenic
1165026069 19:32962504-32962526 ATTTTCTTCTAGAAGTGTTATGG - Intronic
1165566023 19:36728391-36728413 ATTTCCTGCTAAAAGAAACCAGG + Intronic
924976170 2:177724-177746 ATTTCCTTCTAGTTGAATAAAGG + Intergenic
925450375 2:3964286-3964308 ATTTCCTTTTGAAAGTATAAAGG - Intergenic
925576163 2:5362683-5362705 ATTTTATTCTAAAAGAAATTTGG + Intergenic
926486392 2:13465341-13465363 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
926526009 2:13981818-13981840 ATTTTCCTCTAAAAGAAACAAGG + Intergenic
926667251 2:15539564-15539586 CTTTGCTTCTAAAATAAATAGGG - Intronic
926852577 2:17215781-17215803 ATTTTCTTCTAAGAGTTTTATGG - Intergenic
927286742 2:21364585-21364607 TGTTCCTTCTAACAGAATTTTGG - Intergenic
927542344 2:23924275-23924297 ATTTCTTTCTACAAAAATAAGGG + Intronic
927801759 2:26106903-26106925 ATTTTCTTCTAAAAGCCTTATGG - Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929186781 2:39103678-39103700 GTTTTCTTCTAAGAGATTTATGG - Intronic
930153793 2:48084648-48084670 GTTTTCTTCTAATACAATTATGG - Intergenic
930310669 2:49735568-49735590 ATTTCCTTATTATAAAATTAAGG - Intergenic
930351860 2:50266576-50266598 TTTTCTTTCTAGAAGAACTAAGG + Intronic
930636946 2:53816713-53816735 ATTTCCTTCTAAAGACTTTATGG + Intronic
930791660 2:55338592-55338614 ATTTCCCACTAAAAGGAATAAGG + Intronic
930804174 2:55473433-55473455 ATTTTCTACTTAAAAAATTATGG - Intergenic
930816130 2:55599904-55599926 ATTTCCTTTGAAATGAATGAAGG - Intronic
930942989 2:57035971-57035993 ATTTGCTGGTAAAAGAACTACGG + Intergenic
931326067 2:61224980-61225002 ATTTCCCACTGAAAGAATTGGGG - Intronic
931596740 2:63954116-63954138 ATTTCCTACTAAAAGAAAGTAGG + Intronic
932385502 2:71328637-71328659 ATTTTCTTCCAAATGAATAAAGG - Intronic
932499056 2:72165420-72165442 GTTTCCTTCTAAGAGTTTTATGG - Intergenic
932528947 2:72505191-72505213 ATTATCTTCTAAAAGATTTATGG + Intronic
933383793 2:81584194-81584216 ATGTAATTCTAAAAGAATTTGGG + Intergenic
933420307 2:82036692-82036714 ATTTCCTGCTAAGAGTATAAGGG - Intergenic
934180536 2:89615294-89615316 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
934290836 2:91689557-91689579 ATTTCCTTCTAGGAGTTTTATGG - Intergenic
934707493 2:96494221-96494243 ATTTCAGTCTTAAAGAAATATGG + Intergenic
934723498 2:96598961-96598983 ATGTGATTCTAAAAGAATAATGG + Intronic
935523037 2:104132923-104132945 ATTTTATTTTAAAATAATTATGG - Intergenic
936694992 2:114935483-114935505 ATTTTCATCTATCAGAATTATGG + Intronic
938075990 2:128337693-128337715 ATTTTTTTCTAAAAGATTCAGGG - Intergenic
938847549 2:135225823-135225845 ATTTTCTTGTAAAGGAATAATGG + Intronic
939036618 2:137139293-137139315 ATGTCCATCTAAAAGAATGGAGG - Intronic
939527505 2:143315760-143315782 ATTTATTTCTTAAAGGATTAAGG - Intronic
939543571 2:143523910-143523932 ATTTCATTTTAAAAAAATTGTGG - Intronic
939769673 2:146299538-146299560 ATTTACTTGTAAAAGAACTCAGG + Intergenic
939921872 2:148125940-148125962 ATTTCCTTCTAAGCTAATCATGG - Intronic
940172256 2:150842346-150842368 ATTTACCTCAAAAAGAATTCAGG - Intergenic
940467809 2:154054547-154054569 TTTTCATTTTAAAAAAATTAAGG + Intronic
940667997 2:156632475-156632497 CTTTCCTTCTAAAAGAAGACTGG + Intergenic
940962305 2:159798797-159798819 ATTTCCTTCTAATTGGATTCAGG + Intronic
941251826 2:163174802-163174824 GTCTCCTTTTAAAAGAGTTAAGG + Intergenic
941398285 2:164998391-164998413 ATTTCTTTCTAAAATATTTATGG + Intergenic
941484181 2:166059014-166059036 ATTTCATTCCAAAAAACTTAAGG + Intronic
941533957 2:166700125-166700147 ATTTCCTTTTTAAAAAATTTAGG + Intergenic
941580306 2:167289069-167289091 GTTTCCTTTAAAAAGAATTGTGG - Intergenic
941742837 2:169054181-169054203 ATTTCTTTAAAAAAAAATTACGG - Intergenic
941925367 2:170888974-170888996 ATTTCCTTTTATTAAAATTATGG - Intergenic
942027774 2:171927565-171927587 ATTTCCTACTAAAAGAAACCAGG - Intronic
942134891 2:172915377-172915399 AATTCCTGCTGAAATAATTATGG + Intronic
942154618 2:173115394-173115416 ATTTACCTGAAAAAGAATTAAGG - Intronic
942408113 2:175676911-175676933 ATTTTCTTCTAGAAGTATTTGGG + Intergenic
942550674 2:177113950-177113972 ATGTCCTTCTAAATTACTTAAGG + Intergenic
943003902 2:182365163-182365185 ATTTCATTCTTAAAGAGTTCTGG - Intronic
943783870 2:191854761-191854783 ATCTCCTCCTAAAACAATTATGG + Intergenic
943937177 2:193934810-193934832 ATTTATTTCAAAAAGAATTCAGG - Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944280810 2:197894305-197894327 ATTTGCTCCAAATAGAATTACGG - Intronic
944363505 2:198888344-198888366 CTTTCCTTATAAAAAATTTAAGG + Intergenic
944493978 2:200287861-200287883 GTTCTCTTCTAAAAGAGTTATGG - Intergenic
945205185 2:207324016-207324038 ATTTCTTTCTGGAAGAAGTATGG + Intergenic
945286728 2:208089969-208089991 ATTTGCTTCTTAAAAAATTCTGG + Intergenic
945458242 2:210073244-210073266 ATTTCCTACTAAAAGGAATCGGG - Intronic
945549774 2:211206393-211206415 ACCTTCTTTTAAAAGAATTATGG - Intergenic
945565552 2:211394076-211394098 ATTTCCTTTTAAAATATTCATGG + Intronic
945983241 2:216333043-216333065 GTTTTCTTCTAGAAGAGTTATGG - Intronic
948406693 2:237726798-237726820 ATTTCCTTATAGATGAATTAAGG + Intronic
948582097 2:238994909-238994931 GTTTCTTTCTAAAATAAATATGG - Intergenic
948796900 2:240409264-240409286 ATTGCCTTATATAAGAATTCAGG - Intergenic
1169517347 20:6332500-6332522 ATTTGCCTCAAAAAGAATTCAGG - Intergenic
1169652587 20:7886003-7886025 ATTTCCTTCTCAAAGAAGAGAGG + Intronic
1171127235 20:22613213-22613235 ATTTCCTTATATATGAATTGAGG + Intergenic
1171415257 20:24974135-24974157 ATTTTCTTCTAAAGGATTTCTGG - Intronic
1171983409 20:31642886-31642908 ATTTCATTCTAACAGAATTAGGG - Intronic
1173377618 20:42502009-42502031 ATTTGCTTGTAAAACAATTTGGG + Intronic
1173542632 20:43866236-43866258 ACTTTCTTCTAAAAGAGATAAGG + Intergenic
1175125593 20:56749118-56749140 TTTTTTTTCTAAAAGACTTAGGG - Intergenic
1175709970 20:61211797-61211819 TTTTCCTTGGAAAAGAATAACGG + Intergenic
1175759024 20:61548763-61548785 ATTTCTTTTTAGAAGAATAATGG - Intronic
1175808153 20:61842464-61842486 AATTCCTTCTAAAAGATCTGAGG - Intronic
1176731948 21:10507852-10507874 ATTTCCTTCTAGGAGTTTTATGG + Intergenic
1177464346 21:21456637-21456659 ATTTTCTTCTAGTAGATTTATGG - Intronic
1177531811 21:22370556-22370578 ATTTCCTCATAAAGGAATAATGG + Intergenic
1178164005 21:29950829-29950851 ATCTCCTTCTTTAAGAAGTAAGG + Intergenic
1178221641 21:30667484-30667506 ATTTGCTTCTGTGAGAATTAGGG + Intergenic
1178801792 21:35802061-35802083 ATTTACTTGAAAAAGAATTCAGG + Intronic
1179373924 21:40832373-40832395 ATTTCCCTAAAAAAGAATGAGGG - Intronic
1179606158 21:42516637-42516659 ATTTCTTTTTAAAACAATGATGG - Intronic
1181672411 22:24431896-24431918 ATTTCCTTCTCATAGAATCATGG + Intronic
1181883877 22:26003481-26003503 CTTTCTGTCTAAAAGAACTAGGG - Intronic
1183033657 22:35124380-35124402 AGTTCCTTCTAAAAGCCTTCTGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184916444 22:47572168-47572190 ATTTTCTCATAAAACAATTAGGG - Intergenic
949356279 3:3183462-3183484 ATTTCCTTTAAAAACAATTTTGG - Intergenic
949649612 3:6141031-6141053 AATTCCTTCTATAACAAATATGG + Intergenic
950059759 3:10060676-10060698 AATGCATTCTAAAAGAATCAGGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951450018 3:22826797-22826819 CTTTACTTATAAAAGAATCAGGG + Intergenic
951686409 3:25349447-25349469 ACTTCCTACTTACAGAATTATGG + Intronic
951855774 3:27195342-27195364 ATTGAGTTCTGAAAGAATTAGGG - Intronic
953175242 3:40545268-40545290 ATTTTTTTCTAAAATATTTAAGG - Intronic
954045692 3:47927937-47927959 AATTCCTTCTGGAAGAATTAAGG + Intronic
954229342 3:49204510-49204532 CTTTCCTTCTGAAAGAATTTTGG + Intronic
955230331 3:57093446-57093468 CTTTTCTTTTAAAAGAAATAAGG - Exonic
956944081 3:74198825-74198847 ATTTCAATCTAAGAGAATTTAGG - Intergenic
957390929 3:79567919-79567941 ATTGCTTTCTAAAAAAAGTATGG + Intronic
957627604 3:82673727-82673749 ATTTCCTTGTCATAGAATTTAGG - Intergenic
958168162 3:89904390-89904412 ACATAATTCTAAAAGAATTAGGG - Intergenic
958446042 3:94216347-94216369 ATTTTCTTCTCAAAGAGTTGGGG - Intergenic
958646976 3:96887065-96887087 ATTTACCTCAAAAAGAATTCAGG - Intronic
958804301 3:98791219-98791241 TTTTCTTTCTAAAAGTATAATGG + Intronic
959310692 3:104732604-104732626 ATGTCCCTCTAAAAGGATTGTGG + Intergenic
959694003 3:109230415-109230437 ATTTACTTCAAAAAAAAATATGG + Intergenic
960658449 3:120032074-120032096 ACATCCTTCAAAAAAAATTAAGG - Intronic
960921425 3:122750663-122750685 ATTTCCTACAAAAAGAACTGTGG + Intronic
962963177 3:140330136-140330158 ATTCCCTTCCCAAAGAGTTAGGG - Intronic
962993049 3:140597172-140597194 ATTTTCTTCTCACAGCATTAAGG + Intergenic
963294881 3:143535076-143535098 ATCTCCTTTTAAAAGAAGAATGG - Intronic
964014854 3:151932640-151932662 ATTTCCCTCTAAAAAACCTAGGG + Intergenic
964404409 3:156334102-156334124 ATTTTCTTCTAAAACTTTTATGG + Intronic
964520220 3:157558024-157558046 GTTTTCTTCTAAGAGTATTAAGG - Intronic
964534694 3:157707260-157707282 ATTTTCTTCTAAAATTTTTATGG - Intergenic
964778624 3:160310130-160310152 ATTTCCTTCCAAAAGGAGCAAGG + Intronic
964911559 3:161788812-161788834 ATTTTCTACTAAAAGAAATCAGG - Intergenic
965115772 3:164485653-164485675 ATTTGCTTCTAAAAGAAATCTGG - Intergenic
965257713 3:166437402-166437424 ATTTCCTAGTCAAAAAATTATGG + Intergenic
965638027 3:170804057-170804079 AGTTACTTTTAAAAGAAGTAGGG - Intronic
966403021 3:179565813-179565835 AAATCCTTCAAAAAAAATTAGGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966954707 3:184863734-184863756 ATTTCCTACTTAAAGATTTGTGG - Intronic
967003711 3:185363052-185363074 GATTCCTTCTAAAAGAAGGAAGG + Intronic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
969328413 4:6457762-6457784 ATTTCTTTGTAAAAGACATATGG + Intronic
970398132 4:15691488-15691510 ATTTCCTGCTAGTAGAATTTAGG + Intronic
970529596 4:16968432-16968454 ATTTCCTTCTGAAAATATGATGG - Intergenic
971283524 4:25264175-25264197 ATTCACTTCTAAAACAATTTAGG + Intronic
971611635 4:28733028-28733050 AATCCCTTCTAAAAGAGTTCTGG - Intergenic
971900942 4:32657780-32657802 ATTTACCTCTAAAAGAATTCAGG - Intergenic
971951854 4:33361101-33361123 ATTTAACTTTAAAAGAATTATGG + Intergenic
972195896 4:36653649-36653671 ATTTCCTTCTGAAAGTTTTAGGG - Intergenic
972443885 4:39124703-39124725 ATTTTCTTCTCAAAGTTTTATGG - Intronic
972712767 4:41614386-41614408 CTTTCCTTCTAAAAGTACAAAGG - Intronic
972798109 4:42443074-42443096 TTTTCATTTTGAAAGAATTAGGG - Intronic
973714196 4:53658727-53658749 ATGCCTTTTTAAAAGAATTAAGG + Intronic
973831453 4:54764138-54764160 ATTTACTTGAAAAAGAATTCAGG - Intergenic
974179765 4:58369240-58369262 ATTTTCTTCTAGAAGTTTTACGG - Intergenic
974196345 4:58580733-58580755 ATTTTCTTCTAAAATTTTTATGG + Intergenic
974796925 4:66765228-66765250 TTTTCCTTAAAAAAGCATTAAGG + Intergenic
975374416 4:73626992-73627014 GTTTTCTTCTAAAAGTGTTATGG + Intergenic
975386950 4:73769108-73769130 CTTTCCCTCTAAAGGACTTAAGG + Intergenic
975398345 4:73904029-73904051 TTTTGCTTCACAAAGAATTAAGG - Intergenic
975409296 4:74030541-74030563 ATTTCCTTGTAACTGTATTATGG - Intergenic
975895897 4:79089816-79089838 ATGCACTTCTAAAAGAAGTAAGG - Intergenic
977101157 4:92816638-92816660 ATTTGCTACTAAAAGAGTTCTGG + Intronic
977106916 4:92897775-92897797 ATCTGCTTACAAAAGAATTAGGG - Intronic
977168970 4:93736711-93736733 TATTCCTTCTAAAATAATAATGG - Intronic
977251824 4:94697097-94697119 ATTTACTTCTAAATTATTTAAGG - Intergenic
977285711 4:95104185-95104207 ATATCCTCCTGAAAGGATTATGG + Intronic
977311145 4:95388885-95388907 ATTACTTTTTAAAAAAATTAGGG - Intronic
977934850 4:102790063-102790085 ATTTTCTTCTAAGAGTTTTATGG + Intergenic
978489162 4:109292856-109292878 ATTTTTTACTGAAAGAATTAGGG - Intronic
978549687 4:109912165-109912187 TTTTCCTTCTAAGATAATTTAGG - Intergenic
978691137 4:111512043-111512065 ATCTCCTTGTAAAAGTATTCTGG + Intergenic
979681740 4:123467487-123467509 ATTGCCTGCTAAATAAATTAGGG + Intergenic
979859087 4:125671422-125671444 ACTTTCTTTTAGAAGAATTAAGG + Intergenic
980411905 4:132430954-132430976 CTTTCCTACTTAAAGAATAAAGG - Intergenic
980514181 4:133832467-133832489 ATTTCCTTCTGATATAAGTAGGG + Intergenic
981333205 4:143536848-143536870 CTTACCTTCTAAGAGACTTAAGG - Intronic
981810741 4:148771090-148771112 ATTTCAAAATAAAAGAATTATGG + Intergenic
981907357 4:149936916-149936938 GTTTCCTTCTAGAAGTTTTATGG + Intergenic
982752880 4:159183449-159183471 ATTTTCTTCTAAAAGTTGTATGG - Intronic
983597451 4:169486683-169486705 ATATTCTTATAAAAGCATTATGG - Intronic
983692512 4:170488717-170488739 AGTTCTTTGTAAACGAATTATGG - Intergenic
983784386 4:171714512-171714534 AATTACTTCTAAAAGCATTTTGG + Intergenic
984738192 4:183131569-183131591 ATTTGCTTCTAAAATACTTAAGG - Intronic
985258738 4:188095181-188095203 ATTTCCTTCCAAAAGTTTTATGG - Intronic
985858946 5:2455121-2455143 ATTTCCTCTTAAAAGCATAAGGG + Intergenic
985881833 5:2644246-2644268 ATTTCCTTCTCAGATAATAAAGG + Intergenic
986424402 5:7615948-7615970 ATTTCATTCTTAAATAATCATGG - Intronic
986440986 5:7781583-7781605 ATGTCCTTCTGAAACCATTAGGG - Intronic
987126608 5:14818773-14818795 ATTTCTTTGTAAAAGAATCAAGG - Intronic
987776946 5:22379630-22379652 ATTTCCTTAACAATGAATTAGGG + Intronic
987822677 5:22985820-22985842 ATTAACTTTTAAAAGAATTGAGG - Intergenic
988144332 5:27285395-27285417 ATTTACTTCTACAAAAATTATGG + Intergenic
988542108 5:32119597-32119619 ATTTCATGCTAAAAGAAACATGG + Intergenic
988886801 5:35566752-35566774 GTTTTCTTTTAAAAGAATCAAGG + Intergenic
988946849 5:36212150-36212172 AATTGCTTCAAGAAGAATTAAGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989635900 5:43533221-43533243 AGTTCCATCTAATACAATTAAGG + Intronic
989776331 5:45212264-45212286 ATTTCCTTATAAAAGAATTGTGG + Intergenic
990132632 5:52606146-52606168 ATTTCCTTTTAAATGAATCATGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990712726 5:58603788-58603810 ATTTGCCTGAAAAAGAATTAAGG - Intronic
991368587 5:65894883-65894905 AGTTCCTTCTATTAGAATTAGGG + Intergenic
991510311 5:67369104-67369126 TTTTGCTTTTAAAAGAAGTAGGG - Intergenic
991923985 5:71685084-71685106 ATTTCCCTGAAAAAGAATTCAGG + Intergenic
992260153 5:74961566-74961588 ATTTCCATCTAATAGAAAGATGG - Intergenic
992318782 5:75589065-75589087 AATTCTTAGTAAAAGAATTATGG - Intronic
992825393 5:80544939-80544961 ATTCTCTTCTAAATGCATTAAGG - Intergenic
992843387 5:80719023-80719045 ATTTCCTACTAAAAGAAACTAGG - Intronic
993009446 5:82463517-82463539 ATTTTCTTCTAGAATACTTATGG - Intergenic
993262682 5:85680048-85680070 ATTTTTCTCTAAAATAATTATGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
993529513 5:89006628-89006650 GTTCTCTTCTAAAAGATTTATGG + Intergenic
994241590 5:97427982-97428004 AATACTTTCTAAAACAATTAAGG + Intergenic
994702517 5:103154237-103154259 ATTTTCTTCTAAAAGGCTGAGGG - Intronic
995069827 5:107907330-107907352 ATTTCATTCTAAAAGCACAAAGG - Intronic
995350729 5:111172503-111172525 ATTTCCATATAAGAGAAGTAGGG - Intergenic
995567808 5:113450120-113450142 ATTTCATTCTGAGAGACTTAGGG - Intronic
995645907 5:114311183-114311205 ATTTCCTCCTAAAAAGATAATGG + Intergenic
996003389 5:118390412-118390434 ATTTCTTAGTAAAAGACTTAAGG - Intergenic
996156758 5:120112053-120112075 AATTCTTTCTAAAATAATGAAGG - Intergenic
997289839 5:132721699-132721721 TTTTACTACTAATAGAATTAGGG - Intronic
997838257 5:137214450-137214472 CTTTCTTTCTAAATGAATGATGG - Intronic
998069550 5:139186373-139186395 AATTCCTTGTAAAATAATAAAGG - Intronic
998879996 5:146635975-146635997 ATTTTCTTTTAAAATAACTATGG - Intronic
999556676 5:152751217-152751239 GTTTTCTTCTTAAAGAATTTTGG - Intergenic
999913299 5:156230161-156230183 ATTTACTCCAAAAAGAATTCAGG - Intronic
1000816177 5:165924863-165924885 ATTTACTTCCAGAAGAATTATGG + Intergenic
1001582812 5:172810763-172810785 ATTTTCTTCTAAGAGTTTTAAGG - Intergenic
1002109449 5:176898463-176898485 ATTACCTTCGAAAAGGACTAAGG + Intronic
1002969725 6:2002283-2002305 ATTTCCTTCCAATAGGATAAAGG - Intronic
1003450998 6:6231083-6231105 ATTTACCTGAAAAAGAATTAAGG + Intronic
1003498483 6:6685083-6685105 ATTTCTTTGTAAAAGACTTATGG - Intergenic
1003531137 6:6938592-6938614 ATTTACTTTTAAAAAAAATATGG + Intergenic
1003725562 6:8758924-8758946 ATGTCCTTTTAAAAAAATTCTGG + Intergenic
1003731770 6:8832579-8832601 ATTTAGTGCTAAAAGAAATAAGG - Intergenic
1003750723 6:9052243-9052265 ATTTCTTTCTAAAGAAATTGAGG + Intergenic
1004035893 6:11923034-11923056 TTTTCCCTCTAAAATATTTAAGG + Intergenic
1004765152 6:18717998-18718020 AATTCTTTCTAAAACGATTACGG + Intergenic
1004876266 6:19957874-19957896 TTTTCTTTCTAAAAGAATTTAGG - Intergenic
1004907930 6:20253932-20253954 ATTTCCCTCTAAAAGAAACCAGG - Intergenic
1004949672 6:20654549-20654571 ATTTTCTTCTAAAAGTTTCATGG + Intronic
1005166426 6:22926921-22926943 TTTTCTTTCTAAAAGCATTTGGG - Intergenic
1006482240 6:34305282-34305304 ATTTACTTTTAAAATAATTCAGG - Intronic
1008246488 6:49180538-49180560 GTTTCCTTTTAAAAAAAATATGG + Intergenic
1008268175 6:49457913-49457935 AATTCCATCAAAAAGAATTTTGG + Exonic
1008599448 6:53076274-53076296 CTTTTCTTCTAAAAGGTTTATGG + Intronic
1008604672 6:53128789-53128811 TTTTCCTTCTCCAAGAGTTATGG - Exonic
1008935341 6:56986034-56986056 AATTACTACTAACAGAATTATGG + Intronic
1009026166 6:58002871-58002893 TTGGGCTTCTAAAAGAATTAAGG + Intergenic
1009201714 6:60754345-60754367 TTGGGCTTCTAAAAGAATTAAGG + Intergenic
1009319473 6:62269137-62269159 ATTTTCTTCTAGAAGCTTTATGG - Intronic
1009709176 6:67295773-67295795 ATTTTCTTCTAAGATTATTATGG + Intergenic
1009747037 6:67829716-67829738 TTTTCATTTTAAAAGAGTTATGG - Intergenic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1010045403 6:71437032-71437054 ATTTACCTGTAAAAGAATTCAGG + Intergenic
1010164990 6:72905357-72905379 ATTTACCTGTAAAAGAATTCAGG - Intronic
1010439084 6:75872528-75872550 ATTTCCTTATCATAGAAATATGG + Intronic
1010562315 6:77365807-77365829 TTTTCCTTTTTAAAAAATTATGG - Intergenic
1010579932 6:77583105-77583127 ATTTTCTTCTAGAAGTTTTATGG - Intergenic
1012314735 6:97772410-97772432 GTTTCATACTAAAAGAGTTAAGG + Intergenic
1013347166 6:109272089-109272111 ATTTTCTTCTAAGAGATTTATGG + Intergenic
1014317260 6:119883415-119883437 TTTTCCTTTTAAAAGAACCAAGG - Intergenic
1014842134 6:126232368-126232390 ATTTCCTTTTAAATAAAATATGG + Intergenic
1015452388 6:133385794-133385816 ATTTCTTCCCAAAAGAATTAAGG - Intronic
1015579008 6:134703182-134703204 ATTTCATTCTAAAAGACTAATGG + Intergenic
1015687225 6:135878036-135878058 ATTTCCTTCTCTATAAATTAGGG - Intronic
1015901176 6:138069436-138069458 ATTTACCTCTAAAGGAATTAAGG - Intergenic
1015932614 6:138376522-138376544 ATTTGCTTCTAAAGAAATGAAGG + Intergenic
1016969361 6:149748504-149748526 GTTTCCTTCTAAAAGATTACTGG + Intronic
1017367765 6:153665402-153665424 TTTACCTTCCAAAAGAATTTTGG + Intergenic
1017963861 6:159246746-159246768 TTTTCCTCCTGAAAAAATTATGG + Intronic
1018151197 6:160940921-160940943 ATTTTCTTCTAAAAGCATTATGG + Intergenic
1018435596 6:163755619-163755641 ATTTTCTTAGAAAAGAATCAGGG - Intergenic
1018865126 6:167740543-167740565 ATTTTCTTCTCGAAGCATTAGGG + Intergenic
1020062567 7:5163503-5163525 GTTACCTTCTAAAAGTTTTATGG - Intergenic
1020165587 7:5805194-5805216 GTTACCTTCTAAAAGTTTTATGG + Intergenic
1020968140 7:14898973-14898995 ATATCCTTAAAAAAGAATTTCGG + Intronic
1021666982 7:22993281-22993303 ATTTTCTTCTAAAAGCCTTATGG - Intronic
1022851976 7:34273057-34273079 ACTTCCTTCTAATGGAAGTAAGG - Intergenic
1023961705 7:44932760-44932782 GTTATCTTCTAAAAGCATTACGG - Intergenic
1024035936 7:45507260-45507282 ATTTGCAACTAAAAGAACTAGGG - Intergenic
1024090099 7:45930332-45930354 ATTTTCTTCTAATAGTTTTATGG + Intergenic
1024445251 7:49470312-49470334 ATTTTCTTCTGACAGAATGAAGG - Intergenic
1024921695 7:54563911-54563933 ATATTCTTCTCAAAAAATTATGG + Intronic
1025921413 7:65916512-65916534 ATTTCCCCCTAAAAGAATCTAGG - Intronic
1025948805 7:66126984-66127006 TTTTCCTTCTAAAATAAAAATGG - Intronic
1026410890 7:70121234-70121256 ATTTTCTTCTAAGAGTTTTATGG - Intronic
1026491175 7:70865244-70865266 GTATCCTTCTAAAAGTTTTATGG + Intergenic
1027287519 7:76662904-76662926 CTTTCCTTCTTAAACAACTAGGG - Intergenic
1027289439 7:76688267-76688289 ATTTCCTACTATATGAACTAGGG - Intergenic
1027350340 7:77305692-77305714 ATTTCCCTGAAAAAGAATTCAGG - Intronic
1027621650 7:80494107-80494129 ATTTCCTTATTAAGGAATTCAGG + Intronic
1027982755 7:85247925-85247947 ATTATCTTCTAAAAGTTTTATGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029821036 7:103147819-103147841 CTTTCCTGCTACAAGAATTATGG - Intronic
1030326528 7:108225062-108225084 ATTTCTATCTAAAATAATGAAGG + Intronic
1030339493 7:108360880-108360902 ATTTTCTTCTAATAGTTTTATGG - Intronic
1030522783 7:110618912-110618934 ATTTCCTCCTAAGAGAATTCTGG + Intergenic
1030983557 7:116213468-116213490 ATTTCATGTAAAAAGAATTAAGG + Intronic
1031108817 7:117581027-117581049 ATTACCTTATAAACGAATTGAGG - Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031392230 7:121229623-121229645 ATTTTCTTATAAATTAATTATGG - Intronic
1031937924 7:127754952-127754974 ATTTAGGTCTAAAAGAAATAAGG - Intronic
1031946574 7:127848013-127848035 CTTTACTTCTAAAAGGATTCTGG + Intronic
1032185239 7:129719438-129719460 ATTTCATTTTAAAAGAAGTATGG + Intronic
1032289385 7:130574709-130574731 ATTTACCTGTAAAAGAATTCAGG + Intronic
1032449031 7:132011533-132011555 ATTGCCTTATAAAACAAATAGGG + Intergenic
1033077621 7:138264353-138264375 ATTGCCTTCTAAAAGCTTTCTGG + Intergenic
1033470567 7:141644717-141644739 ATTTCCTTTTTAAAGAAAAATGG - Intronic
1033502105 7:141962123-141962145 ATTTTTTTCTAAAAGAAGTCAGG + Intronic
1033505498 7:141995687-141995709 TTTTCCTTCCAAAAGTCTTAAGG + Intronic
1034031485 7:147771235-147771257 ATTATCTTCTAAAAGCTTTATGG - Intronic
1034597641 7:152213600-152213622 ATTTCCTTCTAGGAGTTTTATGG - Intronic
1035927415 8:3743493-3743515 AGTTTCTTCAAAAAGAATAATGG + Intronic
1035960950 8:4137497-4137519 TTTTCCTTTTAAAAATATTATGG + Intronic
1037511149 8:19584811-19584833 TTTTTCTCCTAACAGAATTAAGG + Intronic
1038263255 8:26016547-26016569 ATTTCCCTCTTAAAGCATTCAGG - Intronic
1038446581 8:27608755-27608777 ATTTGCTTCTGAAAGCATCAGGG - Intronic
1038622451 8:29156947-29156969 ATTTCCTTCTCCAATAATAATGG + Intronic
1038834192 8:31100631-31100653 ATTTCCTTTTAAAATTCTTAAGG + Intronic
1039130026 8:34252933-34252955 ATTTCCTTCTAATGAAATGAGGG - Intergenic
1039330096 8:36528138-36528160 ATTTCTTTCTGTAAAAATTATGG + Intergenic
1039635456 8:39159786-39159808 AATTTGTTCTCAAAGAATTATGG - Intronic
1039667729 8:39553965-39553987 ATTTTCCACTAAAAGAAATATGG + Intergenic
1040390896 8:46949721-46949743 ATTTCCTTCCAAAATATTTAGGG + Intergenic
1040938279 8:52804785-52804807 ATTTTTTTCTAAAAGTATTTAGG + Intergenic
1041768259 8:61443343-61443365 CTTTCTTTCTAAAAGTTTTATGG + Intronic
1042240182 8:66656106-66656128 ATTTTTTTCTAATAAAATTATGG + Intronic
1042406344 8:68409629-68409651 ATTCCTTTCTTCAAGAATTAAGG - Intronic
1042907877 8:73792001-73792023 ATTTCTTTATAAAAGCATTTTGG + Intronic
1043371013 8:79592730-79592752 ATTCCCTACTAAAAGAATTCAGG + Intergenic
1043602285 8:81955090-81955112 ATTTCCTTCTATCAGAAAAAGGG + Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044123416 8:88426253-88426275 ATTTTATTCTAAAAGGGTTAGGG - Intergenic
1044896465 8:96897941-96897963 CATTCTTTCAAAAAGAATTATGG + Intronic
1044982215 8:97728180-97728202 ATTACTTTCCAAAAGACTTAGGG + Exonic
1045400577 8:101812695-101812717 GGAACCTTCTAAAAGAATTAGGG + Intronic
1045449858 8:102311467-102311489 ATTTCCATCTCGAAGAATAATGG + Exonic
1046070659 8:109248976-109248998 ATTTCTTTTTATTAGAATTAGGG - Intronic
1046175021 8:110564163-110564185 ATTTCCTGCTATAAGTATTAAGG - Intergenic
1046338199 8:112818413-112818435 ATTTACTTGTAAAATAATTTTGG + Intronic
1047022563 8:120791334-120791356 TTTTCCTTCTAGAATTATTATGG - Intronic
1047232316 8:123008060-123008082 ATTTTATTTTAAAAAAATTAAGG - Intergenic
1048062347 8:130933387-130933409 ATTTTCTTCTAAACACATTAAGG + Intronic
1048637928 8:136319262-136319284 AAATCATTCCAAAAGAATTATGG - Intergenic
1050517931 9:6464514-6464536 ATTACCTTCTAAAAGCTTTGTGG + Intronic
1050580948 9:7055866-7055888 CTTTCTTTCTGAAAGAATCAAGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050863836 9:10471854-10471876 ATTTCCTTTTCAAATAATTATGG - Intronic
1051756733 9:20408881-20408903 ATTTCTTTCAAAAAGAAAGAAGG - Intronic
1051777218 9:20648756-20648778 ACTTCCTTTTAAAAAAATTGGGG + Intergenic
1052246989 9:26347724-26347746 ATTTACCTGAAAAAGAATTAAGG + Intergenic
1052588615 9:30461992-30462014 ATTTCTTCCTAAAAGGGTTAGGG - Intergenic
1052789696 9:32863811-32863833 AGTTCCTCCTAAAAGATGTAGGG - Intergenic
1052953607 9:34234043-34234065 ATTTCCTTCTCAGAGATTTAGGG + Intronic
1054536032 9:66235772-66235794 ATTTACTTCTAAGAAAATTGGGG - Intergenic
1055656543 9:78455261-78455283 GTTTCCTTTTAAAATACTTATGG - Intergenic
1055804986 9:80082757-80082779 ATTTCCTTCTAGAATATTTTAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056175620 9:84032080-84032102 ATTTTCCACTAAAAGAAGTAAGG - Intergenic
1057311197 9:93944305-93944327 ATTTCCTCCCAAAAGATTTTTGG - Intergenic
1058348080 9:103988554-103988576 GTTTCCTTCTTAAAAAAATAGGG - Intergenic
1058817688 9:108700467-108700489 ATTTTCTTCTAGAACATTTAAGG + Intergenic
1059259113 9:112959058-112959080 AGTGCCTTCCAAAAGCATTAGGG - Intergenic
1059636762 9:116179055-116179077 ATTTCCTTGTAAACTATTTAAGG - Intronic
1059677844 9:116556722-116556744 ATTTGCTTATAAAAGAGTTATGG - Intronic
1062603953 9:137334619-137334641 ATTTCCTTCTAGAATGTTTATGG - Intronic
1186008414 X:5101403-5101425 ATTTCCTAGTAAAAGAACTAGGG - Intergenic
1186372197 X:8958764-8958786 ATTTCCTAAGAAAAGAAATAAGG - Intergenic
1186375936 X:9001324-9001346 TTTTCCTTCTAGCAGATTTATGG - Intergenic
1187344447 X:18450094-18450116 ATTTCACTTCAAAAGAATTAAGG - Intronic
1187344455 X:18450154-18450176 ATTTCACTTCAAAAGAATTAAGG - Intronic
1187530164 X:20089089-20089111 ATTTTCTTCTAGAAGTTTTATGG + Intronic
1187862957 X:23699182-23699204 ATGTCCCTCTCAAAGAATAAAGG - Intergenic
1187888202 X:23908363-23908385 AGTTACTTCTACAAGTATTAAGG - Intronic
1188038960 X:25350220-25350242 ATTTTCTTCTAAGAGTTTTATGG + Intergenic
1188090805 X:25963498-25963520 GTTTCCTTCTGTAAGATTTATGG - Intergenic
1188303649 X:28535636-28535658 ATTTCCCCAGAAAAGAATTAGGG - Intergenic
1189594592 X:42550259-42550281 ATTTCCTTCTATTAGAACTCTGG + Intergenic
1190510002 X:51165084-51165106 AATTCTTTCAAAAAGAATTTTGG + Intergenic
1191053103 X:56215371-56215393 ATTTCATTCTAAAATACTTTTGG + Intergenic
1191154574 X:57258329-57258351 ATTTTCTTCTCTAAGATTTATGG - Intergenic
1192098311 X:68236779-68236801 ATTTACTTGCAAAAGAATAAAGG - Intronic
1192399171 X:70817379-70817401 ATTTTCTACTAAAATAAATAAGG + Intronic
1192399534 X:70820890-70820912 GTTTTCTTCTAAAAGTTTTACGG - Intronic
1193437977 X:81502570-81502592 ATTTACTTGAAAAAGAATTCAGG - Intergenic
1194366181 X:93017186-93017208 CTATCCTTCTACAAGAATTCAGG + Intergenic
1194528988 X:95020547-95020569 GTTTCCTTCTAGAAGTTTTAAGG - Intergenic
1194546897 X:95247242-95247264 ATATACTTCTAAAAGAATGAAGG - Intergenic
1194879429 X:99232913-99232935 ATTACATACTGAAAGAATTATGG + Intergenic
1195100093 X:101547140-101547162 ATATCTTTCTAAAATAATTTGGG - Intergenic
1195797265 X:108664456-108664478 GTTTTCCTCTAAAAGCATTATGG - Intronic
1196068569 X:111493621-111493643 ATTACCTTCAAAAATAATTTAGG - Intergenic
1196460791 X:115928151-115928173 TTTTCTTTTTAAAAAAATTATGG - Intergenic
1196970764 X:121105941-121105963 ATTTCCTTCCAACAGACTGAAGG - Intergenic
1197838607 X:130721442-130721464 CTTTCCTTCAAAAAGCATTTTGG + Intronic
1198152949 X:133929048-133929070 GTTTTCTTCTAAAAGGTTTATGG + Intronic
1198581732 X:138073202-138073224 ATTTTGTTCTCAAAGAATTGTGG + Intergenic
1199248349 X:145631944-145631966 ATTTCCTTGCAAAAGGGTTAAGG + Intergenic
1199300029 X:146202457-146202479 GTTTTCTTCTAAAAGATTTATGG + Intergenic
1199545188 X:149001158-149001180 GTTTCCTTCAAAAAGATTTCTGG + Intergenic
1199889567 X:152063044-152063066 ATTTACTACAAAAAGAAATAAGG - Intergenic
1200271409 X:154688048-154688070 ATTTCCTTCTAAAAGAATTATGG - Intronic
1200674408 Y:6133453-6133475 CTATCCTTCTACAAGAATTCAGG + Intergenic
1201506492 Y:14706702-14706724 ATTACATCCTAAAAGAACTAAGG - Intronic
1202046411 Y:20740650-20740672 GTTTTCTTCTTAAAGAAATATGG + Intergenic
1202071896 Y:21000565-21000587 CTTTCCTTAGTAAAGAATTATGG - Intergenic