ID: 1200272649

View in Genome Browser
Species Human (GRCh38)
Location X:154700424-154700446
Sequence CAGCATTAAGGGCCCAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 7, 3: 30, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200272642_1200272649 30 Left 1200272642 X:154700371-154700393 CCTTGTAACGAGCAGGAGAACAG 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1200272649 X:154700424-154700446 CAGCATTAAGGGCCCAATTGAGG 0: 1
1: 1
2: 7
3: 30
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200272649 Original CRISPR CAGCATTAAGGGCCCAATTG AGG Intronic
903953826 1:27011777-27011799 CAACATTAAGTGACCAATTTAGG - Intronic
904571232 1:31467123-31467145 CAGCAGTAAGGACCCAATAAGGG + Intergenic
907671569 1:56478670-56478692 CAGCATTAACCACCCATTTGGGG - Intergenic
908282076 1:62550545-62550567 TAGCATTAAGGGCTCTCTTGAGG + Intronic
909295017 1:73936585-73936607 CAGCATTAAGGGCTCATTTTAGG + Intergenic
909752113 1:79175190-79175212 CAGCTTTAAGGACCCACTTGAGG - Intergenic
909813688 1:79963370-79963392 CAATATTAAGGGAACAATTGAGG + Intergenic
909969160 1:81958746-81958768 GAGCATGAAGGGCCCATCTGAGG - Intronic
910438869 1:87231993-87232015 CAGCATTAAGGACCCACTTAGGG - Intergenic
912958487 1:114173744-114173766 CAGCACCAAGGGCTCACTTGCGG + Intergenic
916384065 1:164247666-164247688 TAGCATTAGGAGCCCATTTGAGG + Intergenic
917864684 1:179182340-179182362 CAGTGTTAAGGGCTCATTTGAGG - Intronic
919045748 1:192449583-192449605 AAGCATTTAGGGCCAGATTGTGG - Intergenic
919968429 1:202553284-202553306 CAGCTTTTATGGCCCAACTGGGG - Intronic
921619416 1:217309570-217309592 CAGCATAAAAGCCCCAGTTGTGG - Intergenic
923580515 1:235207295-235207317 GAGAATTAAGGACCCACTTGAGG + Intronic
924504215 1:244666033-244666055 CAGTATTTAGGGCCCTCTTGGGG - Intronic
924904833 1:248441403-248441425 CAGCATTTTGGGCACAATGGTGG - Exonic
924923054 1:248650639-248650661 CAGCATTTTGGGCACAATGGTGG + Exonic
1064756376 10:18575138-18575160 CTACATCAAGGGACCAATTGGGG + Intronic
1066093267 10:32047459-32047481 CAGTATTAAGGGCCCACTCAAGG - Intronic
1069358935 10:67620149-67620171 CACCATCAAGGGCCAAAGTGGGG + Intronic
1071483489 10:86082295-86082317 CAGCATGAAGGACCCATTTGAGG + Intronic
1072391841 10:94995107-94995129 CTGCATTGAGGGACCCATTGGGG - Intergenic
1072577858 10:96716958-96716980 CAGGATTCAGAGCCCAATGGAGG + Intronic
1075817691 10:125278111-125278133 CAACATTACGGGTCCAGTTGGGG + Intergenic
1077585914 11:3453053-3453075 AGGCATTAAAGGTCCAATTGAGG - Intergenic
1078713337 11:13816217-13816239 CAGCATTAAAAGTCCACTTGAGG + Intergenic
1079311024 11:19366154-19366176 CAGCATGATGGGCCCAGCTGGGG + Intronic
1080557001 11:33427117-33427139 CAGCACCAAAGGCCCACTTGAGG - Intergenic
1082059801 11:47850109-47850131 CAGCATTATGGGCCCACTCAAGG - Intergenic
1083121683 11:60519582-60519604 CAGCATTAAGGACATACTTGAGG + Intronic
1085802174 11:79600885-79600907 CAGCATGGAGGGCACAACTGTGG - Intergenic
1087251315 11:95903534-95903556 CAGTATTAAGGGTCTAGTTGAGG - Intronic
1090464490 11:126922250-126922272 CAGCATGGAGGGGCCAGTTGAGG - Intronic
1093657779 12:21716890-21716912 CAGCACTGAGGGCCCACTTGAGG + Intronic
1093996159 12:25645071-25645093 CAGTACTAAGGGCCTATTTGAGG + Intronic
1094874459 12:34625571-34625593 TGGCATTAAGGTCCCAATTGAGG - Intergenic
1096937593 12:55300170-55300192 CAGCATTAAATGCACATTTGGGG + Intergenic
1100128858 12:91465019-91465041 CAACATTAAGGGCTTAACTGAGG + Intergenic
1100536127 12:95511334-95511356 CAGGATTAAGGGCACAAGGGAGG - Intronic
1105790241 13:23791311-23791333 CCACGTTAAGGGCCCAAGTGGGG - Intronic
1109233966 13:59792928-59792950 TAGCATTAAGAATCCAATTGAGG - Intronic
1110410581 13:75200199-75200221 CAGTATTAAAGGCCAAATTGAGG + Intergenic
1112725674 13:102301735-102301757 CAGCACTAAAGGCGCACTTGAGG - Intronic
1112728287 13:102330050-102330072 CAGCATTAAGGGTCCACTTGGGG - Intronic
1112938733 13:104833853-104833875 AAGCATTAAAGGCTCATTTGAGG + Intergenic
1113007381 13:105722462-105722484 CAGTATTAAGAGCCCTTTTGGGG - Intergenic
1114145959 14:19978856-19978878 CTGCATCAAGGGACCCATTGTGG + Intergenic
1114501519 14:23172577-23172599 CAGCATTCCCGGCCCAACTGGGG + Intronic
1114607799 14:24012153-24012175 AGGCATTAAAGTCCCAATTGAGG - Intergenic
1114638541 14:24203233-24203255 CAGCATTGAGGGCCCAACTGAGG - Intronic
1116725801 14:48560466-48560488 CTGCATCAAGGGACCCATTGAGG + Intergenic
1117140277 14:52784010-52784032 CAGCCTGAAGGGCCTAATTTTGG - Intronic
1117149040 14:52866629-52866651 AAGCATAAAGGGCCCAGCTGAGG - Intronic
1122382655 14:101320498-101320520 CTGCATTAAGGGACCCACTGGGG + Intergenic
1123219572 14:106843416-106843438 CATCATTTGGGTCCCAATTGGGG + Intergenic
1202927769 14_KI270725v1_random:7235-7257 CATCATTAAGGAAACAATTGAGG + Intergenic
1125353225 15:38789434-38789456 CTGCATTAAGGTCCCAATTAGGG + Intergenic
1125410185 15:39398089-39398111 CAACATCAAGGGCCCAACTGTGG - Intergenic
1130433696 15:83874776-83874798 CAGCAATTAGGGCCCATCTGAGG + Intronic
1130734922 15:86538067-86538089 CAGCATAAAGGGTCCCACTGTGG + Intronic
1131351497 15:91704919-91704941 CAGCTTTAATGGCCTCATTGTGG + Intergenic
1132095450 15:98981122-98981144 CAGCAGAAAAGTCCCAATTGAGG + Intronic
1134851174 16:17480208-17480230 CAGCATTGAGGACCCGCTTGCGG - Intergenic
1138684849 16:58716051-58716073 CAGCAATCCGGGCCCCATTGAGG + Exonic
1141156586 16:81601387-81601409 CAGCATCGGGGGCCCAATGGGGG + Intronic
1144472992 17:15561261-15561283 CAGCACTAAGGGCTCGACTGAGG + Intronic
1144624665 17:16838641-16838663 CAGCATCCTGGGCCCACTTGGGG + Intergenic
1144881765 17:18434080-18434102 CAGCATCCTGGGCCCACTTGGGG - Intergenic
1144923488 17:18783439-18783461 CAGCACTAAGGGCTCGACTGAGG - Intronic
1145150468 17:20510306-20510328 CAGCATCCTGGGCCCACTTGGGG + Intergenic
1146162398 17:30566960-30566982 CAGCATCCTGGGCCCACTTGGGG + Intergenic
1146805253 17:35859761-35859783 CAGCATTAAGGGTCTATATGAGG - Intronic
1150449210 17:65251724-65251746 CAGCGTTAAGGACCCATTTGTGG + Intergenic
1154463090 18:14616427-14616449 CTGCATCAAGGGACCGATTGTGG + Intergenic
1157848456 18:51026035-51026057 CAGCATTAAGGGTCTATCTGAGG + Intronic
1158175770 18:54654356-54654378 CAGCATTCAGGGCCCCTTGGAGG - Intergenic
1159588233 18:70302433-70302455 CAGCATTAAGGACCCACCTGCGG + Intronic
1159840630 18:73394630-73394652 CAGTATTAAGGTCCCAGTCGAGG + Intergenic
1165321827 19:35090380-35090402 CAACATTAGGGGCGCAATCGGGG + Intergenic
1168397297 19:56059492-56059514 CAGCATTGATAGCCCATTTGAGG + Intronic
926490013 2:13513752-13513774 CAGTATTAAGGCCTCAATAGAGG - Intergenic
927389620 2:22580906-22580928 CACCACTAAGGGACCACTTGAGG - Intergenic
929147878 2:38722361-38722383 CAGCATCAAGGGCCCACTAGAGG - Intronic
929369688 2:41207586-41207608 CAGCACAAAGGGCCTACTTGAGG + Intergenic
931609177 2:64080420-64080442 CAGCACTGAGGGCCCAGTTGAGG - Intergenic
931743138 2:65266796-65266818 CAGCAGGAAGGGCTCAGTTGAGG + Intronic
933459258 2:82559728-82559750 AAACATTAAGGGCCAATTTGAGG + Intergenic
935396053 2:102610429-102610451 CAGAATTAAGGACCCACTTGAGG - Intergenic
936294057 2:111251765-111251787 CTGCAATAAGGGCCCAGTTGAGG - Intergenic
942572481 2:177327972-177327994 CAGCAGTGAGGTCCCACTTGAGG + Intronic
944348311 2:198695835-198695857 CTGCACAAAGGGACCAATTGGGG - Intergenic
946053255 2:216881049-216881071 CAGCACCCAGGGCCAAATTGTGG + Intergenic
1168997646 20:2145022-2145044 CAGCGTTAGGGGCCCATTTGTGG + Exonic
1174092026 20:48057007-48057029 CAGCATCAACGTCCTAATTGAGG - Intergenic
1174201188 20:48807864-48807886 GAGCATTCTGGGCCCAAATGAGG + Intronic
1176345865 21:5746158-5746180 AAGCATGCAGGGCCGAATTGGGG + Intergenic
1176352679 21:5866742-5866764 AAGCATGCAGGGCCGAATTGGGG + Intergenic
1176371920 21:6067403-6067425 CAGCACTATGGGCCCATCTGGGG + Intergenic
1176498962 21:7578297-7578319 AAGCATGCAGGGCCGAATTGGGG - Intergenic
1176540186 21:8144228-8144250 AAGCATGCAGGGCCGAATTGGGG + Intergenic
1176559137 21:8327273-8327295 AAGCATGCAGGGCCGAATTGGGG + Intergenic
1176589792 21:8635896-8635918 CATCATTAAGGAAACAATTGAGG + Intergenic
1176811435 21:13541944-13541966 CTGCATCAAGGGACCGATTGTGG - Intergenic
1179751599 21:43471136-43471158 CAGCACTATGGGCCCATCTGGGG - Intergenic
1180272626 22:10612911-10612933 CATCATTAAGGAAACAATTGAGG + Intergenic
1183137538 22:35903616-35903638 GAGAATTAAGGACCCAATTTTGG - Intronic
1184703279 22:46192239-46192261 CAGCATCTTGGGCCCAATTCTGG - Intronic
1203245131 22_KI270733v1_random:60595-60617 AAGCATGCAGGGCCGAATTGGGG + Intergenic
949137498 3:585810-585832 CATCATTAAGGAAACAATTGAGG - Intergenic
957964812 3:87308382-87308404 CAGCATTAAGAGCCTACTTGAGG - Intergenic
960176502 3:114523896-114523918 CAGCATTAACGGCCTCCTTGAGG + Intronic
960745697 3:120885878-120885900 CAGCATTAAGAGTCCACTTAAGG - Intergenic
962500510 3:135986476-135986498 TAACATTAAGGGTCCACTTGAGG - Intronic
964402161 3:156310917-156310939 CAGCAATTAGGGCCCAGATGTGG + Intronic
967724282 3:192847001-192847023 CAGCAATTAGAGCCCAGTTGGGG + Intronic
968247812 3:197171899-197171921 AAGCATTAAGGGCCCATTTTAGG - Intronic
968396641 4:244398-244420 CAGCATTAAAGTCCCAACTGAGG + Intergenic
970235262 4:13952448-13952470 CAGCATGAAGGGCCAAATAATGG - Intergenic
973748054 4:53984064-53984086 CAGCATTAAGGGCCCAGTTAAGG - Intronic
976439456 4:85056487-85056509 CAGCATTAAGGGCCTACTTAAGG - Intergenic
977048121 4:92091996-92092018 AAGCATTAAGGGCCCGCTGGAGG - Intergenic
978631834 4:110756529-110756551 CAGCATCAAGGCACCAGTTGAGG - Intergenic
979006043 4:115298521-115298543 CAGCCTTAATGGCTCACTTGAGG - Intergenic
981000774 4:139826519-139826541 CAGCAATTAGGACACAATTGTGG + Intronic
981185978 4:141803839-141803861 CACCACTAATGGTCCAATTGTGG - Intergenic
981623544 4:146731372-146731394 TAGCATTAAGGGCCCACTTGAGG + Intronic
982305147 4:153922969-153922991 CAACACCAAGGGCCCACTTGAGG - Intergenic
985197627 4:187449170-187449192 CTGCATTCAGGGCCAACTTGAGG - Intergenic
988184117 5:27837429-27837451 TAGCCTTAAGGGCCCACTTGAGG + Intergenic
991127020 5:63081045-63081067 CAGAACTAAAGGACCAATTGAGG + Intergenic
991140531 5:63235726-63235748 CAGCATTAATAGCCCAATACTGG - Intergenic
992081868 5:73241151-73241173 GAGCATTAAGGGCTCACTTGAGG + Intergenic
993828127 5:92719170-92719192 CATCATTAAGGGCCCACTGCAGG - Intergenic
994052997 5:95383103-95383125 AAGCATTAAGGACCCACTTAAGG + Intergenic
997062027 5:130517965-130517987 CAGCATTAGTCGCCTAATTGAGG - Intergenic
998489315 5:142532387-142532409 GAGCTTTAAGGGCCCCATTTAGG + Intergenic
1006501998 6:34465392-34465414 CAGCATTCAGGGCTCAAGTTCGG + Intergenic
1007571969 6:42899314-42899336 CAGCATTAAAGTCCCAATTGAGG - Intergenic
1009789789 6:68386568-68386590 CTGAATTAAGGGCCAAACTGTGG + Intergenic
1012154278 6:95797203-95797225 CATCATTAAGGAACCATTTGAGG + Intergenic
1012267407 6:97162504-97162526 CGGCATTGAGGACCCAATGGAGG - Intronic
1012769524 6:103412682-103412704 TAGCATTCAGGGCACAAATGTGG + Intergenic
1013792288 6:113851364-113851386 CAGTAATGAGGGCCCATTTGAGG - Intergenic
1014038833 6:116800116-116800138 CAGCATTAAGAGCCCACTGGAGG + Intronic
1015041616 6:128727553-128727575 CAGCATTAAGGTGAGAATTGGGG + Intergenic
1015391360 6:132685977-132685999 CAGCATTAGGGATCCAAGTGAGG - Intronic
1016572846 6:145534199-145534221 AAGCAATAAGGGCACAATTTAGG + Intronic
1020745272 7:12071905-12071927 CTGCATCAAGGGACCCATTGGGG + Intergenic
1020984771 7:15119687-15119709 AAGCATAAAGGGCCCATATGAGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021398993 7:20187718-20187740 CAGCATGAAGAGCCCAGCTGGGG - Intronic
1028130635 7:87168760-87168782 CAGCATTATGAGCCCACTTCAGG - Intronic
1030190548 7:106806197-106806219 TGGCATTAAAGGCCCACTTGAGG + Intergenic
1030336242 7:108330354-108330376 GAGCAGTAAGGGCTCAATGGAGG + Intronic
1037396730 8:18451319-18451341 CTGCACTGAGGACCCAATTGCGG + Intergenic
1037397226 8:18456019-18456041 CTGCAGTGAGGACCCAATTGTGG + Intergenic
1038528219 8:28295513-28295535 CAACATTAGGGGCCCAACTAGGG + Intergenic
1038607728 8:29025827-29025849 CAGAATTAAAGACCCACTTGAGG - Intronic
1038829527 8:31041764-31041786 AAGTAGTAAGGGCCCACTTGAGG + Intronic
1040550482 8:48433535-48433557 CAGCATCAACTGCCAAATTGTGG + Intergenic
1040621796 8:49100081-49100103 CTGCATTAAGGGACTCATTGGGG + Intergenic
1041700711 8:60786211-60786233 CAGCATCAGTGGCCCCATTGTGG + Intronic
1058858794 9:109093799-109093821 CAGCATTAAGTTCCCAAAGGAGG - Intronic
1059106958 9:111520380-111520402 CAGTGTTAAGGGCCCATTTGAGG - Intergenic
1060386071 9:123229857-123229879 GAGCATTAAGGACCCATTTGAGG + Intronic
1203461464 Un_GL000220v1:43664-43686 AAGCATGCAGGGCCGAATTGGGG + Intergenic
1203619808 Un_KI270749v1:114544-114566 CATCATTAAGGAAACAATTGAGG + Intergenic
1186356330 X:8794900-8794922 CAGCATTAGGGGTCCAACTGAGG - Intronic
1186596835 X:10990883-10990905 CAGCATCCAAGCCCCAATTGAGG - Intergenic
1186619559 X:11224495-11224517 CAGCATTAGGGGTCCAACTGAGG + Intronic
1188559247 X:31449343-31449365 CAGTGTTGAGGGCCCACTTGAGG + Intronic
1189221393 X:39375280-39375302 AAGTATTAAGGGCCTAATCGAGG + Intergenic
1190388672 X:49910450-49910472 CAACATTAAGTGCCCACTTGAGG - Intergenic
1191185493 X:57607214-57607236 CAGGATTAGGGGCCCACTTAAGG + Intergenic
1196761093 X:119201587-119201609 CAGCATTCAAGGCACCATTGCGG + Intergenic
1197193683 X:123676908-123676930 CAGCATTAAGGGCCCATTTGAGG - Intronic
1198495314 X:137186450-137186472 TACCATTAAGGGACCAATTGAGG + Intergenic
1198868666 X:141153057-141153079 CAGCATTAAGGACTCACTTGGGG + Intergenic
1199495607 X:148448975-148448997 CAGCATTAAGGGTCCACTTGAGG - Intergenic
1199845544 X:151690359-151690381 CTGCATGGAGGGCCCACTTGAGG - Intergenic
1200020708 X:153204271-153204293 CAGCATTAGGGGCCCAAGTGGGG + Intergenic
1200272649 X:154700424-154700446 CAGCATTAAGGGCCCAATTGAGG + Intronic
1202304240 Y:23451257-23451279 CAGCTTTTATGGCCCAACTGGGG - Intergenic
1202566570 Y:26219334-26219356 CAGCTTTTATGGCCCAACTGGGG + Intergenic