ID: 1200274176

View in Genome Browser
Species Human (GRCh38)
Location X:154716281-154716303
Sequence TGCCGCTCATGCGGCCTCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200274169_1200274176 30 Left 1200274169 X:154716228-154716250 CCGGATGGGCTTGCTGGAGTGCT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1200274176 X:154716281-154716303 TGCCGCTCATGCGGCCTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 31
1200274170_1200274176 3 Left 1200274170 X:154716255-154716277 CCTGTAGTACTCCAAGACATCGG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1200274176 X:154716281-154716303 TGCCGCTCATGCGGCCTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 31
1200274174_1200274176 -8 Left 1200274174 X:154716266-154716288 CCAAGACATCGGGGTTGCCGCTC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1200274176 X:154716281-154716303 TGCCGCTCATGCGGCCTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200274176 Original CRISPR TGCCGCTCATGCGGCCTCGC CGG Exonic