ID: 1200277530

View in Genome Browser
Species Human (GRCh38)
Location X:154748873-154748895
Sequence CACTTCGACGGGGCCTGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200277530_1200277535 -1 Left 1200277530 X:154748873-154748895 CCTATCCAGGCCCCGTCGAAGTG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1200277535 X:154748895-154748917 GACACATGATCACCATCTAGTGG 0: 1
1: 0
2: 2
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200277530 Original CRISPR CACTTCGACGGGGCCTGGAT AGG (reversed) Intronic
903367919 1:22816347-22816369 AACTTCCACGGGGCATGGGTAGG - Intronic
922013860 1:221622728-221622750 CACGGCTATGGGGCCTGGATTGG + Intergenic
924573758 1:245260738-245260760 CCCTTGTACTGGGCCTGGATGGG + Intronic
1063304570 10:4885507-4885529 CACTTCTCCAGGGCCTGGAGAGG + Intergenic
1079103223 11:17554349-17554371 CTCTTTGACAGTGCCTGGATTGG + Intronic
1083951833 11:65960884-65960906 CACTGCGCCTGGCCCTGGATTGG - Intergenic
1091813355 12:3418153-3418175 CACTTGGCTGGGGCCTAGATGGG - Intronic
1093593249 12:20931761-20931783 CACTTAGAAGGAGGCTGGATTGG - Intergenic
1122895207 14:104753348-104753370 CGCTGCGTCGGGGCCTGGAACGG + Intronic
1144641638 17:16940344-16940366 GACTTTGACGGGGCCTTGAGCGG + Exonic
1147869372 17:43576851-43576873 CACTGCTACGAGGCCTAGATGGG + Intronic
1151552168 17:74828482-74828504 CCCTTCTACAGGGCCTGGAAGGG - Intronic
1155059968 18:22219723-22219745 CTCTTTGGCGGGGCCTGGAGAGG + Intergenic
1166798013 19:45439780-45439802 CACGGCGAGGGGGCCTCGATCGG - Intronic
1167740797 19:51323900-51323922 CCCTTGGCCGGGGCCTGGCTGGG + Intronic
937447612 2:121972012-121972034 CTCTTCAACTGGGCCTGCATAGG - Intergenic
938701790 2:133886035-133886057 CACTGGGGCGGGGCCTGGCTGGG - Intergenic
945935913 2:215902504-215902526 CACTTCCACTGGGGTTGGATTGG - Intergenic
1176342961 21:5715063-5715085 CACTGCCACAGGGCCTGGCTGGG - Intergenic
1176475215 21:7147214-7147236 CACTGCCACAGGGCCTGGCTGGG - Intergenic
1176501866 21:7609393-7609415 CACTGCCACAGGGCCTGGCTGGG + Intergenic
1176537282 21:8113132-8113154 CACTGCCACAGGGCCTGGCTGGG - Intergenic
1176680592 21:9817216-9817238 CACTCCGAGGGGGCCAGAATGGG - Intergenic
1176681161 21:9820028-9820050 CACTCCGATGGGGCCAGAATGGG - Intergenic
1176681733 21:9822856-9822878 CACTCCGAGGGGGCCAGAATGGG - Intergenic
1180874961 22:19170975-19170997 CCCCTCCACAGGGCCTGGATGGG - Intergenic
1203242226 22_KI270733v1_random:29536-29558 CACTGCCACAGGGCCTGGCTGGG - Intergenic
950045816 3:9947929-9947951 GACGTCGAGGGGGCCTGGACTGG + Exonic
961389305 3:126542832-126542854 CCCATCTACGGGGCCTGGAGAGG - Exonic
988560434 5:32276173-32276195 CATTGCGAAGGAGCCTGGATTGG - Intronic
994114977 5:96051587-96051609 CACTTTGAACTGGCCTGGATTGG + Intergenic
1000415973 5:160984223-160984245 CATTACGACAGGGCCAGGATGGG + Intergenic
1014343205 6:120233898-120233920 CACTTCAAACAGGCCTGGATGGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1018907694 6:168084970-168084992 CACGTCCACGGGGCCTGCAGTGG - Intergenic
1058037257 9:100266226-100266248 CCCTCTGACGGGGTCTGGATCGG - Intronic
1060420070 9:123462011-123462033 CACTTCGGCTGCGCCTGGAAGGG + Intronic
1061175453 9:128993339-128993361 CAGTTCGATGAGGCCTGGCTGGG - Exonic
1203458554 Un_GL000220v1:12613-12635 CACTGCCACAGGGCCTGGCTGGG - Intergenic
1196385750 X:115147803-115147825 CACTTTGGGGGGGCCTAGATGGG + Intronic
1200277530 X:154748873-154748895 CACTTCGACGGGGCCTGGATAGG - Intronic