ID: 1200278641

View in Genome Browser
Species Human (GRCh38)
Location X:154757887-154757909
Sequence GCCTGCTCAGGTTCAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200278641_1200278648 14 Left 1200278641 X:154757887-154757909 CCTCCCCCTGAACCTGAGCAGGC No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200278641 Original CRISPR GCCTGCTCAGGTTCAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr