ID: 1200278648

View in Genome Browser
Species Human (GRCh38)
Location X:154757924-154757946
Sequence ACCATAGACTGCAACAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200278639_1200278648 15 Left 1200278639 X:154757886-154757908 CCCTCCCCCTGAACCTGAGCAGG No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data
1200278647_1200278648 2 Left 1200278647 X:154757899-154757921 CCTGAGCAGGCTTGTGGCTGCTT No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data
1200278643_1200278648 10 Left 1200278643 X:154757891-154757913 CCCCTGAACCTGAGCAGGCTTGT No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data
1200278645_1200278648 8 Left 1200278645 X:154757893-154757915 CCTGAACCTGAGCAGGCTTGTGG No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data
1200278641_1200278648 14 Left 1200278641 X:154757887-154757909 CCTCCCCCTGAACCTGAGCAGGC No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data
1200278644_1200278648 9 Left 1200278644 X:154757892-154757914 CCCTGAACCTGAGCAGGCTTGTG No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data
1200278642_1200278648 11 Left 1200278642 X:154757890-154757912 CCCCCTGAACCTGAGCAGGCTTG No data
Right 1200278648 X:154757924-154757946 ACCATAGACTGCAACAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200278648 Original CRISPR ACCATAGACTGCAACAAAAA TGG Intergenic
No off target data available for this crispr