ID: 1200278650

View in Genome Browser
Species Human (GRCh38)
Location X:154757943-154757965
Sequence ATGGCATGATGAGACTTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200278645_1200278650 27 Left 1200278645 X:154757893-154757915 CCTGAACCTGAGCAGGCTTGTGG No data
Right 1200278650 X:154757943-154757965 ATGGCATGATGAGACTTCCAAGG No data
1200278643_1200278650 29 Left 1200278643 X:154757891-154757913 CCCCTGAACCTGAGCAGGCTTGT No data
Right 1200278650 X:154757943-154757965 ATGGCATGATGAGACTTCCAAGG No data
1200278649_1200278650 -5 Left 1200278649 X:154757925-154757947 CCATAGACTGCAACAAAAATGGC No data
Right 1200278650 X:154757943-154757965 ATGGCATGATGAGACTTCCAAGG No data
1200278644_1200278650 28 Left 1200278644 X:154757892-154757914 CCCTGAACCTGAGCAGGCTTGTG No data
Right 1200278650 X:154757943-154757965 ATGGCATGATGAGACTTCCAAGG No data
1200278642_1200278650 30 Left 1200278642 X:154757890-154757912 CCCCCTGAACCTGAGCAGGCTTG No data
Right 1200278650 X:154757943-154757965 ATGGCATGATGAGACTTCCAAGG No data
1200278647_1200278650 21 Left 1200278647 X:154757899-154757921 CCTGAGCAGGCTTGTGGCTGCTT No data
Right 1200278650 X:154757943-154757965 ATGGCATGATGAGACTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200278650 Original CRISPR ATGGCATGATGAGACTTCCA AGG Intergenic
No off target data available for this crispr