ID: 1200279362

View in Genome Browser
Species Human (GRCh38)
Location X:154763256-154763278
Sequence GTCCCACGCCACCGCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200279362_1200279368 7 Left 1200279362 X:154763256-154763278 CCCACCCCGCGGTGGCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200279362 Original CRISPR GTCCCACGCCACCGCGGGGT GGG (reversed) Intronic
902747006 1:18481111-18481133 TTCCCACCCCACCGCTGGGCTGG - Exonic
1067071760 10:43137900-43137922 CTCCCACGCCACCGCGAGCACGG - Intergenic
1075601752 10:123774288-123774310 GTTCCACGCCACCCCGCTGTGGG - Intronic
1076802423 10:132836702-132836724 GTCCCAGGCCTCCCTGGGGTGGG + Intronic
1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG + Exonic
1087976656 11:104557516-104557538 GTCACAGGCCACCTTGGGGTTGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG + Intergenic
1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG + Intronic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1120835558 14:89035744-89035766 GCCCCACTCCATCGCCGGGTAGG + Intergenic
1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG + Intronic
1128687797 15:69699705-69699727 GTCCCAGGCCACGGTGGGGTCGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132799728 16:1746080-1746102 GTCCCAGGCAGCCGCTGGGTGGG - Intronic
1132872628 16:2122542-2122564 GTCCCACCCCACGGCGGGGATGG - Intronic
1134551725 16:15141742-15141764 GTCCCACCCCACGGCGGGGATGG - Intergenic
1142121180 16:88387385-88387407 GTCCCCCGGCACCCGGGGGTGGG - Intergenic
1147741103 17:42671350-42671372 CTCCCACACCACGGCGGGGGAGG - Exonic
1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG + Intergenic
1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG + Intergenic
1156331700 18:36129461-36129483 GCGCCACGCCCCCGCGGCGTCGG - Intronic
1161033405 19:2070602-2070624 GTCCAAGGCCACAGCGGGCTAGG + Intergenic
1161039165 19:2100823-2100845 GACCGAGGCCACCACGGGGTGGG + Intergenic
1162962689 19:14137150-14137172 GTCGAGCGCCACCGCGGTGTTGG + Intergenic
1163305038 19:16472340-16472362 GTCCCGACCCTCCGCGGGGTGGG - Intergenic
1163635068 19:18433837-18433859 GCCCGACGCCGCCGCGGGGGGGG - Intronic
925172369 2:1758160-1758182 GTCCAACACCACCTCAGGGTTGG + Intergenic
926445434 2:12935985-12936007 TTCCCACTGCACCGCTGGGTGGG - Intergenic
926629402 2:15123089-15123111 CTCCCAGGCTACCTCGGGGTGGG - Intergenic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1174176931 20:48651228-48651250 GTCCCACGCTACCTAGTGGTGGG + Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1174298863 20:49568105-49568127 GGCCCAAGCCATCGCGGGGCTGG + Exonic
1174597569 20:51696227-51696249 GCCCCAACCCACCGAGGGGTTGG - Intronic
1176414671 21:6467683-6467705 GTCCCAGGCTGCGGCGGGGTGGG - Intergenic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1179690171 21:43076005-43076027 GTCCCAGGCTGCGGCGGGGTGGG - Intronic
1180953007 22:19729197-19729219 GTGCCAGGCCACCGCTGGGGAGG - Intergenic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1181694976 22:24588484-24588506 GTGCCAGGCCACAGCCGGGTTGG - Intronic
1184796776 22:46737733-46737755 GTCCCACCTCCCCGCGGGGATGG + Intronic
954327473 3:49871283-49871305 GACCCACCCCACCACTGGGTAGG + Intergenic
968850617 4:3075126-3075148 GTCCCAGGCTACGGCGGGGATGG + Intronic
969050403 4:4369002-4369024 GTCCCACTCCACCATGGGGCTGG - Intronic
969112388 4:4852070-4852092 GTCCTTCCCCACCCCGGGGTGGG - Intergenic
970191740 4:13524370-13524392 GACGCACGCCAACGCGGGCTTGG + Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
975922444 4:79408237-79408259 TTCCCAGGCCACGGCGGTGTTGG + Exonic
987310083 5:16673681-16673703 CTCCCACACCACCGCTGGGGAGG - Exonic
996738186 5:126776642-126776664 GTCCCCGGCCACCGCGGGCGTGG - Intronic
997999141 5:138610362-138610384 GGCACACGCCACCGCGCGCTTGG + Intergenic
1002053908 5:176587571-176587593 TTCCCACACCACCGAGGGCTGGG + Intronic
1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG + Intronic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1029604493 7:101590418-101590440 GCACCAGGCCACCGCGGGGGTGG - Intergenic
1051835728 9:21335392-21335414 GTCCCAGGATACCACGGGGTGGG + Intergenic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1059176643 9:112174899-112174921 GTCCCCCGGCGTCGCGGGGTCGG + Intronic
1062668856 9:137694418-137694440 GTCCTGCGCCACCGCATGGTGGG - Intronic
1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG + Intergenic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic