ID: 1200279368

View in Genome Browser
Species Human (GRCh38)
Location X:154763286-154763308
Sequence TGTCTGTGCTGCTGCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 495}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200279362_1200279368 7 Left 1200279362 X:154763256-154763278 CCCACCCCGCGGTGGCGTGGGAC 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495
1200279363_1200279368 6 Left 1200279363 X:154763257-154763279 CCACCCCGCGGTGGCGTGGGACG 0: 1
1: 0
2: 1
3: 6
4: 35
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495
1200279358_1200279368 15 Left 1200279358 X:154763248-154763270 CCGTGCTGCCCACCCCGCGGTGG 0: 1
1: 0
2: 0
3: 15
4: 188
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495
1200279364_1200279368 3 Left 1200279364 X:154763260-154763282 CCCCGCGGTGGCGTGGGACGTGG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495
1200279367_1200279368 1 Left 1200279367 X:154763262-154763284 CCGCGGTGGCGTGGGACGTGGCA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495
1200279366_1200279368 2 Left 1200279366 X:154763261-154763283 CCCGCGGTGGCGTGGGACGTGGC 0: 1
1: 0
2: 0
3: 5
4: 100
Right 1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG 0: 1
1: 0
2: 3
3: 46
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200279368 Original CRISPR TGTCTGTGCTGCTGCCAGCC CGG Intronic
900166390 1:1245766-1245788 CGTCTCTGCTGCAGCCAGCCCGG - Intronic
900326693 1:2111653-2111675 TGGCGGGGCTGCTGCCGGCCTGG + Intronic
900561659 1:3310033-3310055 TGTCTGTGCTGCACCCAGGAAGG - Intronic
900943380 1:5815512-5815534 TGGCTGTGCTGCTGCCTGGAAGG + Intergenic
901030879 1:6306125-6306147 GGACTGTGCTGCTGCCATCTTGG - Intronic
901344515 1:8527911-8527933 TTTCTGAGCTGCTGCCAGGAAGG - Intronic
901472420 1:9466861-9466883 TGTGTGTGCTGCTGTCGGCTGGG - Intergenic
901680568 1:10910387-10910409 TGTCTGAGCTGCTGCTGGCGGGG - Intergenic
902256164 1:15189969-15189991 TGTCTTTGCTACTGACGGCCTGG + Intronic
902359135 1:15932545-15932567 TGCCTGTGCTGCAGCCCCCCTGG - Exonic
902634475 1:17726110-17726132 TGCCTTTGGTGCTGCCTGCCAGG - Intergenic
903171542 1:21557597-21557619 TGTATCTGCTGTTGCCAGGCTGG + Intronic
903450901 1:23453002-23453024 TGGCTGACCTGCTGCCCGCCAGG + Intronic
903837908 1:26217765-26217787 TGTCTCTGGTTCTGCCACCCAGG + Intergenic
903975235 1:27145440-27145462 TGTCTTTGCATCAGCCAGCCAGG - Intronic
905092733 1:35442389-35442411 GGTCTGGGCTGCTCCCAGCTTGG + Intronic
905285913 1:36880332-36880354 TGTGTGTGCTGCTGCTAGGGTGG + Intronic
905945569 1:41898672-41898694 ACTCTGTGCTGATGGCAGCCAGG - Intronic
906241502 1:44245005-44245027 TGTGTGAGGAGCTGCCAGCCTGG - Intronic
906404865 1:45533841-45533863 TGTCTGCTCTACTTCCAGCCTGG + Intergenic
906456481 1:46001621-46001643 TATATGTGCTGCTGCCAGGGTGG + Intronic
907434137 1:54433193-54433215 TGTCTTTGCTGTTGTCAGACAGG - Intergenic
907512966 1:54975960-54975982 TTTCTTTCCTGCTGTCAGCCAGG - Intergenic
908044083 1:60149422-60149444 AGTTTCTGCTGCTGACAGCCTGG - Intergenic
908146993 1:61256872-61256894 TGTGTGTGCTTGTGCCAGCCTGG + Intronic
909704831 1:78569007-78569029 TGTCTGTGATGGTGACAGGCAGG - Intergenic
913347417 1:117821977-117821999 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
913699938 1:121364658-121364680 GTTCTTTGCTGCTGCCACCCAGG - Intronic
914040485 1:144045100-144045122 GTTCTTTGCTGCTGCCACCCAGG - Intergenic
914137602 1:144915379-144915401 GTTCTTTGCTGCTGCCACCCAGG + Intronic
914231685 1:145767909-145767931 GGACTGTGCTGCTGCCATCTCGG - Intronic
914965213 1:152251269-152251291 TGTATGTGCTCCTTCCAGCTTGG + Intergenic
915086922 1:153395280-153395302 TGTCTGTGGTTCTGCCAGGCTGG + Intergenic
917167819 1:172133106-172133128 TGTCTCTGCTGCTAACACCCAGG - Intronic
917488244 1:175474849-175474871 TGTCTGTGCTTCTGACAGCTAGG - Intronic
918885620 1:190190034-190190056 TGTCTGTGCTGAAGGCTGCCTGG + Intronic
920487353 1:206383367-206383389 GTTCTTTGCTGCTGCCACCCAGG - Intronic
922536101 1:226382038-226382060 CCACTGTGCTGCTGGCAGCCTGG - Intronic
923526477 1:234776737-234776759 TGGCTGTGTGGCTGGCAGCCTGG - Intergenic
924829626 1:247579304-247579326 TGTCTCTGCTGCTGGCAGATTGG - Intergenic
1065424330 10:25583292-25583314 TGTCTGTGCTGCTGGGAAGCAGG - Intronic
1067184690 10:44016591-44016613 TGTTTTTGCTTCTGCCTGCCTGG + Intergenic
1068273215 10:54757101-54757123 TGAATGTTCTGCTTCCAGCCGGG + Intronic
1068667836 10:59696163-59696185 GGACTGTGCTGCTGCCATCTTGG + Intronic
1069649937 10:70039010-70039032 AGTCTCTGCTGCTTCCAGTCTGG + Intergenic
1070081268 10:73190764-73190786 TGATTGTGCTACTGCTAGCCTGG - Intronic
1070506646 10:77119027-77119049 TGTCTGGGCATCTGCCATCCGGG - Intronic
1070551535 10:77494369-77494391 TGTGTGTGCTGAGGCTAGCCAGG - Intronic
1070890637 10:79940390-79940412 TAACTATGCTACTGCCAGCCTGG + Intronic
1070959251 10:80487424-80487446 TGATTCTGATGCTGCCAGCCAGG + Intronic
1071137613 10:82470048-82470070 TGTGTGTGCTGCTGTCAGGTGGG + Intronic
1071186103 10:83047445-83047467 TGTTTATGCTGCTGCCAGAATGG + Intergenic
1071432038 10:85613724-85613746 TGTCTGTGGTGGGGCCAGCATGG - Intronic
1072608924 10:97004012-97004034 TGTCTGGCCTGAGGCCAGCCAGG - Intronic
1072684773 10:97529681-97529703 GGACTGTGCTGCTGCCATCTCGG - Intronic
1073443659 10:103568183-103568205 TGTCTGTTGTGCTGCCAGCCAGG + Intronic
1073466083 10:103695198-103695220 TGCCTGGGCTACTGGCAGCCAGG - Intronic
1074252659 10:111767620-111767642 TGTCTTTGCTGCTGCCAGAGTGG - Intergenic
1074854271 10:117461891-117461913 TGTCAGTGAGGCTGTCAGCCAGG - Intergenic
1074856417 10:117477321-117477343 TGTCTCTTCTGGTGCCTGCCAGG + Intergenic
1075413225 10:122244304-122244326 TGGCAGTGCTGCTCCCAGCCAGG - Intronic
1075777146 10:124996387-124996409 TGTCGCTGCTGCAGCCATCCTGG - Intronic
1076330798 10:129664656-129664678 TGTCTTTGCTGCCCCCATCCTGG - Intronic
1076645911 10:131954107-131954129 TGTCTGTGCTGTTCCCTTCCTGG + Intronic
1076783194 10:132735755-132735777 TTAATCTGCTGCTGCCAGCCCGG - Intronic
1076812119 10:132892314-132892336 TGTCTGTCCTGCTACAAACCTGG + Exonic
1077138438 11:1013000-1013022 TCTCTGTGCTGGTGGCTGCCTGG + Exonic
1077388990 11:2290616-2290638 TGCCTGCCCTGCTGCCAGGCAGG - Intergenic
1077920124 11:6635715-6635737 CAGCTGTGCTGCTGCCTGCCAGG - Intronic
1078085940 11:8233063-8233085 TGCCTGTGCAGAGGCCAGCCTGG - Intronic
1078241077 11:9531209-9531231 GCACTGTGGTGCTGCCAGCCTGG - Intergenic
1079040062 11:17051474-17051496 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1079209472 11:18448476-18448498 GTTTTGTGCTGCTGCCAGGCTGG + Intronic
1079401730 11:20111359-20111381 TGTCTCTGCTGCTGCCCTCGGGG + Intronic
1079479424 11:20864044-20864066 GGGCTGTGCTGCTGCCATCTCGG - Intronic
1080025119 11:27605089-27605111 CGTCTGGGCTGCTGCCAGAGTGG + Intergenic
1081012460 11:37832496-37832518 TTTCTTTGCTTCTGCTAGCCAGG + Intergenic
1081646220 11:44792477-44792499 TGTCTGTCTTGCTGACTGCCTGG + Intronic
1082260932 11:50075916-50075938 TGTCGAGGCTGCTGCCAGGCAGG + Intergenic
1083164424 11:60874818-60874840 AGTCTAGGCTGCTGCTAGCCAGG - Intronic
1083664992 11:64269443-64269465 CGACCGCGCTGCTGCCAGCCTGG + Intergenic
1083724575 11:64621538-64621560 AGTCTGTGCTGCAGGAAGCCTGG - Intronic
1083724684 11:64622004-64622026 AGTCTGTGCTGCAGGAAGCCTGG + Intronic
1083750130 11:64756222-64756244 TCCCTCTGGTGCTGCCAGCCTGG - Intronic
1083829136 11:65219917-65219939 TGCCTCTGCTGCTGCCACCGTGG - Intergenic
1084045276 11:66564524-66564546 TGCCTGTCCTGCATCCAGCCAGG - Intronic
1084234485 11:67777946-67777968 TGTCTGTGCTGCAGACATCATGG + Intergenic
1084274056 11:68042941-68042963 TGTGTGGGCGGCTGCCAGCTAGG - Exonic
1084378668 11:68796709-68796731 TCTCTGTCCTGCTTCCAGGCCGG - Intronic
1084566234 11:69930622-69930644 TGTGTGTGCAGCTGCCACCGTGG - Intergenic
1085374680 11:76048910-76048932 TGGCTGTGCTGCAGCCAAGCAGG + Intronic
1086926288 11:92644062-92644084 TGCCTCTGCTGCTGCCTGCGAGG + Intronic
1087021491 11:93607823-93607845 GGTCTCTGCTGCTGGCAGACGGG + Intergenic
1087812286 11:102621317-102621339 TGGCTGTGCTGCAGCCAAGCGGG - Intronic
1089059782 11:115617110-115617132 TGCCTGGGCTCCTGCCAGCCCGG + Intergenic
1089203686 11:116741012-116741034 TGACAGTGCTGTTGCCAGCCAGG - Intergenic
1089304243 11:117516777-117516799 GGCATGTGCTGCTGTCAGCCAGG + Intronic
1089328658 11:117674787-117674809 TCTCTCTGCTGCTACCAGCTGGG + Intronic
1089734244 11:120538807-120538829 TGACTCTGCTGATGCCAGGCTGG + Intronic
1090322743 11:125862278-125862300 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1090762330 11:129848449-129848471 GGACTGTGCTGCTGCCATCTCGG - Intronic
1092095880 12:5841599-5841621 TCTCTGAGCTGCTCCCACCCTGG + Intronic
1094247108 12:28311229-28311251 TGCCTCTCCTGCTCCCAGCCAGG - Intronic
1095190381 12:39251091-39251113 TGTCTGTGCTGCTGCCTGATAGG - Intergenic
1095799408 12:46256736-46256758 GGGCTGTGATGCAGCCAGCCAGG - Intronic
1096117086 12:49060889-49060911 TGTCTGCCCTGCTGCCGGCCCGG - Intergenic
1096408809 12:51362603-51362625 TGACTGTGCTGCTGTGTGCCTGG + Intronic
1096519915 12:52179248-52179270 TGGCCCTGCTGATGCCAGCCTGG + Intronic
1096670320 12:53194557-53194579 TTTCAGTGCAGCTGCCAGCAAGG + Exonic
1096979796 12:55721821-55721843 TGCCTCTGCTGCAGCAAGCCCGG + Exonic
1097167533 12:57093720-57093742 TGGCTGGGCTCCAGCCAGCCAGG + Intronic
1098150357 12:67540054-67540076 TGCCACTGCTGCTGCCACCCTGG - Intergenic
1098278315 12:68835730-68835752 TGCCTCTGCTGCTGCCAGCAGGG - Intronic
1098425982 12:70366272-70366294 TGTCTGAGCTGGGGCGAGCCCGG - Exonic
1098594583 12:72256836-72256858 TCTCTGTGCTGATGAGAGCCTGG - Intronic
1100819651 12:98419591-98419613 TGGCTGTGCTGCAGCCAAGCAGG + Intergenic
1101531797 12:105580328-105580350 TGTCTGGGCTGCTGGCAGGCAGG + Intergenic
1101579493 12:106030111-106030133 AGACTGTTCAGCTGCCAGCCCGG + Intergenic
1101614844 12:106326231-106326253 TGGATGTGCTCCTGCCTGCCAGG - Intronic
1101745354 12:107537614-107537636 AGGCTGTGCTGCAGACAGCCTGG - Intronic
1102186519 12:110951792-110951814 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1102328527 12:112010644-112010666 TGTCTCTGCAGCTGTCAGCAGGG + Intronic
1102930672 12:116859791-116859813 TCTCAGTGCTGCTGCAAGCTGGG - Exonic
1103624633 12:122208462-122208484 TATCTGTGCTTCTGCCAGCTTGG + Exonic
1104811237 12:131621468-131621490 TGTCTGTGGTGCAGACACCCCGG + Intergenic
1104906396 12:132215693-132215715 TGGCTGTGATGGTGCCAGCCCGG - Intronic
1105871270 13:24507599-24507621 TGTCCCTCCTGCTGCCACCCTGG + Intronic
1105921931 13:24971120-24971142 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1110615336 13:77535329-77535351 TGTCTGTGCCCCTGCCTTCCAGG + Intergenic
1111515829 13:89329380-89329402 GGTCTCTGCTGCTGGCAACCGGG + Intergenic
1112058006 13:95708447-95708469 TGGCTCTGCTGCAGCCATCCAGG + Intronic
1112563876 13:100535930-100535952 TCTCTGTGTCGCTGCCATCCAGG + Intronic
1112591796 13:100770259-100770281 TCTCTGTTCTGCTGCCTGCTTGG + Intergenic
1115235956 14:31208363-31208385 TCTCAGTGCTGCTGCCGACCGGG - Intergenic
1115539984 14:34411363-34411385 GGACTGTGCTGCTGCCATCTCGG + Intronic
1115648345 14:35385408-35385430 TGTGTGAGCTGCTGCCTGCAGGG + Intergenic
1115870296 14:37793301-37793323 TGTCTATGCTGGTTTCAGCCAGG + Intronic
1116373190 14:44162374-44162396 TGGCTGTGCTGCAGCCAAGCAGG + Intergenic
1116496298 14:45564776-45564798 TGTATGTACTCCAGCCAGCCTGG - Intergenic
1116803178 14:49464837-49464859 TGTCTGTTCTGCTGCTAGACTGG - Intergenic
1116840956 14:49820677-49820699 GGACTGTGCTGCTGCCATCTCGG + Intronic
1117803373 14:59466235-59466257 AGTCTAAGGTGCTGCCAGCCTGG + Intronic
1118882776 14:69843052-69843074 TGTGAGTGCTGGGGCCAGCCTGG + Intergenic
1119649961 14:76376474-76376496 TGTCTGTCCTTCTGCCCGTCTGG + Intronic
1119698777 14:76735411-76735433 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1119820481 14:77611413-77611435 TGACTGTGCTACTGCAGGCCAGG + Intronic
1120028102 14:79608643-79608665 TGGCTGTGGTCCAGCCAGCCTGG + Intronic
1120199710 14:81523621-81523643 TGTCTGTGCTTCTGACAGACTGG - Intronic
1120282996 14:82463300-82463322 GCTCTGTGCTGCTTCCAGCTGGG - Intergenic
1120892720 14:89505334-89505356 GGACTGTGCTGCTGCCATCTCGG + Intronic
1121228876 14:92341789-92341811 ATTCTGTTCTGCTGCCAGCACGG - Intronic
1122243569 14:100384661-100384683 GGACTGGGCTGCAGCCAGCCAGG - Intronic
1122518788 14:102327747-102327769 TGTCTGCACTGCTGCCAAACAGG + Intronic
1122860690 14:104581119-104581141 TGTCTGGGGAGCTGCCAGCGTGG + Intronic
1123128786 14:105969134-105969156 AGCCTGTGCTGCTACAAGCCTGG + Intergenic
1123219694 14:106844191-106844213 TTTCTCTGCAGCTGCCAGCATGG + Intergenic
1123409307 15:20045297-20045319 AGCCTGTGCTGCTACAAGCCTGG + Intergenic
1123518638 15:21052005-21052027 AGCCTGTGCTGCTACAAGCCTGG + Intergenic
1124347433 15:28932024-28932046 TTTCTGTGCTGCTGCATCCCAGG + Intronic
1126175643 15:45732957-45732979 ACTCTGTGATTCTGCCAGCCTGG - Intergenic
1126571476 15:50157814-50157836 GGACTGTGCTGCTGCCATCTCGG + Intronic
1126978694 15:54216528-54216550 TGTCTGTTCTGCTGAGTGCCTGG - Intronic
1127390008 15:58497745-58497767 GGGCTGAGCTCCTGCCAGCCAGG - Intronic
1127631221 15:60829158-60829180 TACCTGGACTGCTGCCAGCCTGG + Intronic
1127783125 15:62333227-62333249 GGACTGTGCTGCTGCCATCTTGG - Intergenic
1128113283 15:65089710-65089732 TGTGTGTGCTGGAGCCTGCCTGG + Intergenic
1128536295 15:68493168-68493190 AGTCTCTGCTGCTGACAGACTGG + Intergenic
1128887797 15:71304264-71304286 TGTCTGTGCTGCTCCTCACCAGG + Intronic
1128914533 15:71547695-71547717 TGTCTGTGCAGTTGCCACACTGG + Intronic
1129008584 15:72395914-72395936 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1130522264 15:84672326-84672348 GGACTGTGCTGCTGCCATCTCGG + Intronic
1131156412 15:90078773-90078795 TGTCAGGGCTGCCCCCAGCCTGG + Intronic
1131354260 15:91730877-91730899 TGTCTGTGCTCCAGCCAGGTGGG - Intergenic
1132552047 16:557546-557568 TGTCAGGGCTGCAGCCAGGCTGG - Intergenic
1132703119 16:1230336-1230358 TGTGTGTGGGGCTGCCAGGCAGG + Intergenic
1132705202 16:1240532-1240554 TGTGTGTGGGGCTGCCAGGCAGG - Intergenic
1132708332 16:1255895-1255917 TGTGTGTGGGGCTGCCAGGCAGG - Intergenic
1132875213 16:2134121-2134143 TGTGGGTGCTGTTGCCAGGCAGG + Intronic
1133001835 16:2855806-2855828 TCTCTGTGCTGCTGGGGGCCTGG - Exonic
1133202459 16:4212611-4212633 TGTATGTGCTGCTGCCAGGGTGG + Intronic
1134027564 16:10965948-10965970 TGTCTGTGCTGCTGGTGGTCTGG + Intronic
1134129241 16:11637460-11637482 TGTTTCTGCTGCTGGCAGCTGGG + Intergenic
1134519774 16:14913269-14913291 TGTGGGTGCTGTTGCCAGGCAGG - Intronic
1134554157 16:15152966-15152988 TGTGGGTGCTGTTGCCAGGCAGG + Intergenic
1134707446 16:16311925-16311947 TGTGGGTGCTGTTGCCAGGCAGG - Intergenic
1134960097 16:18400200-18400222 TGTGGGTGCTGTTGCCAGGCAGG + Intergenic
1136006646 16:27334963-27334985 TGTCTGTCATCCTGACAGCCAGG - Intronic
1136091458 16:27923198-27923220 TGGCTCTGCTGCTCCCGGCCAGG + Intronic
1136282961 16:29224712-29224734 TGCCTGTGTTGCTTCCAGCCTGG - Intergenic
1136366433 16:29811309-29811331 TATCTGTGCTGCCGCCAGTAAGG - Intronic
1136871500 16:33811739-33811761 AGCCTGTGCTGCTACAAGCCTGG - Intergenic
1137493327 16:48951166-48951188 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1137751436 16:50863765-50863787 TGTCTGTGCTGTTGCGATGCAGG + Intergenic
1138043233 16:53697421-53697443 GGACTGTGCTGCTGCCATCTCGG + Intronic
1138699485 16:58846984-58847006 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1139888117 16:70225393-70225415 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1140630385 16:76845476-76845498 GGTCTGTGATGCTACCTGCCAGG - Intergenic
1141871356 16:86788820-86788842 TTTCTCTGCTGCAGACAGCCAGG - Intergenic
1142029979 16:87833655-87833677 TGCCTGTGTTGCTGCCATCCCGG + Intronic
1142087337 16:88190613-88190635 TGCCTGTGTTGCTTCCAGCCTGG - Intergenic
1142213432 16:88819330-88819352 TGCCTGTCCTGGTCCCAGCCTGG + Intronic
1142222613 16:88863071-88863093 TGTCAATGCCACTGCCAGCCTGG - Intergenic
1142364080 16:89640576-89640598 TGTCTGTTCCCCTCCCAGCCTGG + Intergenic
1142364091 16:89640637-89640659 TGTCTGTTCCCCTCCCAGCCTGG + Intergenic
1203100672 16_KI270728v1_random:1304319-1304341 AGCCTGTGCTGCTACAAGCCTGG + Intergenic
1142529708 17:571602-571624 GGACTGTGCTGCTGCCATCTTGG + Intronic
1142694890 17:1628241-1628263 TGTCAGTCCTGCTGCAGGCCAGG - Exonic
1142891607 17:2947638-2947660 CTTCTGTTCTGCAGCCAGCCTGG + Intronic
1143013020 17:3876606-3876628 TGGCTCTGCTGCTCACAGCCTGG - Intronic
1143115395 17:4578962-4578984 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1143277356 17:5721837-5721859 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1143617356 17:8060734-8060756 TTTATGTGCTGCTGCAAGCAGGG + Intergenic
1143689499 17:8549758-8549780 GGACTGTGCTGCTGCCATCTCGG + Intronic
1145026932 17:19475417-19475439 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1145104632 17:20104925-20104947 TGCTTCTGTTGCTGCCAGCCTGG + Intronic
1145920412 17:28605191-28605213 GGACTGTGCTGCTGCCATCTCGG - Intronic
1147044462 17:37743064-37743086 CGTCTCAGCTGCGGCCAGCCCGG + Intronic
1147962783 17:44177918-44177940 TGTCTGTGCTGATGCAAGTGAGG - Intronic
1147974017 17:44237476-44237498 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1148774412 17:50087632-50087654 TGTTTGTCCTGCTGCCAGTAGGG - Intronic
1150293059 17:63992963-63992985 TGACTCTGCCCCTGCCAGCCTGG - Intergenic
1150294340 17:63999637-63999659 TGACTCTGCCCCTGCCAGCCTGG - Intronic
1150477094 17:65483881-65483903 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1151652186 17:75476931-75476953 TGCCTGGGTAGCTGCCAGCCAGG + Intronic
1152128985 17:78465000-78465022 GGACTGTGCTGCTGCCATCTCGG + Intronic
1152525393 17:80885397-80885419 TGTGTGTGTTGCTCCCAGGCAGG - Intronic
1152596105 17:81238635-81238657 TGTCCGTGCTGCTGGCGCCCAGG - Intronic
1153221886 18:2868732-2868754 GGACTGTGCTGCTGCCATCTCGG - Intronic
1154299534 18:13181031-13181053 TGTCTTTTCTTCTGCCAGGCAGG + Intergenic
1154365248 18:13702100-13702122 AGGCTGTGGTGCAGCCAGCCAGG + Intronic
1154498050 18:14976967-14976989 TGACTCTGCTGCACCCAGCCTGG + Intergenic
1156447418 18:37248060-37248082 GGGCCGAGCTGCTGCCAGCCTGG - Intronic
1157897242 18:51480851-51480873 TGTCTGTGCTGCTGAGATCAGGG + Intergenic
1157906996 18:51578040-51578062 TGGCTGAGCTTCTGTCAGCCTGG + Intergenic
1157989498 18:52477855-52477877 TGTTTGTGCCACTGCCAGCCTGG - Intronic
1158878629 18:61755250-61755272 AGGCTGTGCTGCTGCCAGCCTGG + Intergenic
1158937614 18:62379136-62379158 TGTTTGTGATGCAGCCAACCTGG + Intronic
1159955338 18:74515047-74515069 TGTCTGTGCTCCTGCTGACCGGG - Intronic
1160139526 18:76309246-76309268 TGCCTGATCTGCTGCCAGCCAGG + Intergenic
1160265531 18:77338676-77338698 GGTCTGTGCTGCTGACTGTCAGG - Intergenic
1160378584 18:78431734-78431756 TGGAGATGCTGCTGCCAGCCTGG + Intergenic
1160455800 18:78998829-78998851 TGGCTGAGCTGCATCCAGCCAGG + Exonic
1160930335 19:1567208-1567230 TGTCTGGGCCGCCTCCAGCCCGG - Intronic
1161816024 19:6500712-6500734 TGTCTGTCCTGCTGTCACCCAGG - Intronic
1163406453 19:17126061-17126083 TGTCGGGGATGATGCCAGCCAGG - Intronic
1163530215 19:17844319-17844341 TGCATGTGCTGCTGCCCGCTCGG - Exonic
1163558666 19:18006555-18006577 GGACTGTGCTGCTGCCATCTCGG - Intronic
1163945656 19:20531164-20531186 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1164161585 19:22628694-22628716 GGTGGGTGCTGCTGCCAGCTGGG + Intergenic
1164186351 19:22872335-22872357 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1164310013 19:24037318-24037340 TGTCTGTTCTTATGACAGCCAGG - Intronic
1164682517 19:30145132-30145154 TGTCCCTGCTCTTGCCAGCCAGG - Intergenic
1164921467 19:32091678-32091700 TGTTTGTGTTCCTTCCAGCCTGG - Intergenic
1165199223 19:34131931-34131953 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1165358764 19:35320664-35320686 TGTGTGTGCTGTCACCAGCCCGG + Intronic
1165710461 19:38007007-38007029 TGTCTGTGGTGCTGCTAAGCAGG + Intronic
1165842806 19:38798748-38798770 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1166047206 19:40236497-40236519 TGTGTGTGCTGGGCCCAGCCTGG - Intronic
1166997032 19:46724513-46724535 TGCATGGGCTGCTCCCAGCCTGG + Intronic
1167013162 19:46822073-46822095 TGTCTGTGGGGTTGGCAGCCTGG - Intergenic
1167035578 19:46993359-46993381 TGGGTCTGCTGCTGCCAGCTCGG - Intronic
1167435110 19:49474641-49474663 TGACAGTGCTGGCGCCAGCCTGG + Exonic
1167735986 19:51294798-51294820 TGTTTCTGCTCCTGTCAGCCTGG - Intergenic
1168232934 19:55044852-55044874 CGTCTGCTCTGCTGCCAGCAGGG - Exonic
1168567866 19:57439825-57439847 TGTGTGTACAACTGCCAGCCTGG - Intronic
926694756 2:15763464-15763486 TGTCTGTGCTTCTCCCAGGAGGG + Intergenic
926719666 2:15950296-15950318 TGTCTGAGCTGCCACAAGCCAGG - Intergenic
927797005 2:26058171-26058193 TATCTCCGCTGCTACCAGCCTGG + Intronic
929880492 2:45832697-45832719 TGTCTGTGGGGCAGCCTGCCAGG + Intronic
932317635 2:70796423-70796445 GGTCTTTGCTGCTGCAAGGCAGG - Intergenic
932596201 2:73095030-73095052 TATATGTGCTGCAGGCAGCCCGG - Intronic
932702108 2:73999225-73999247 TGGCTGTGCTGCTGCAAGTGAGG + Intronic
933426849 2:82124821-82124843 TGTCAGCACTGCTGCCAGACGGG + Intergenic
933880163 2:86661582-86661604 TGGCTGTGCTGCAGCCAGGCAGG - Intronic
934998688 2:98989627-98989649 GGACTGTACTGCTGCCATCCCGG - Intergenic
935837024 2:107066058-107066080 TGTTTGTGATGCTGAAAGCCTGG + Intergenic
936941764 2:117891014-117891036 TGCCTGTGCTGTTGCCAGGTAGG + Intergenic
937091715 2:119210961-119210983 TGGCTGTGCTGCAGTCAGCAGGG - Intergenic
937296330 2:120811927-120811949 TGTGTTCGCTGCTGCCACCCAGG - Intronic
938470075 2:131551978-131552000 TGTCTGCTCTGTTGCCAGGCTGG + Intergenic
940179270 2:150914061-150914083 TGCTTCTGCTGCTGCCAGTCAGG + Intergenic
940635430 2:156292932-156292954 GGACTGTGCTGCTGCCATCTCGG + Intergenic
940694282 2:156959487-156959509 TGTCTGTGGGACTGGCAGCCTGG + Intergenic
940721384 2:157286105-157286127 ATTCTGTGCTCCTGCCAGCCTGG - Exonic
941793484 2:169576054-169576076 GGACTGTGCTGCTGCCATCTCGG - Intergenic
942725223 2:178999225-178999247 TGTTTTTGCTCCTGACAGCCAGG - Intronic
946416678 2:219543497-219543519 TGTCGGTGCTGCGGCCCGCAGGG - Exonic
948615640 2:239196978-239197000 TGTCTGCACTGCTGCTGGCCTGG + Intronic
1169000329 20:2163616-2163638 TTCCTCTGCTGCAGCCAGCCTGG - Intronic
1169087310 20:2835535-2835557 TGTCTGAGCCGCTGCCTGCAGGG + Exonic
1170322520 20:15115934-15115956 TGTCTTTGATGTTTCCAGCCAGG - Intronic
1170688905 20:18594354-18594376 TGCCATTGCTGCTGCCTGCCTGG + Intronic
1171252124 20:23656384-23656406 GCCCTGTGCTGCTGGCAGCCCGG - Intergenic
1171366291 20:24627012-24627034 GGACTGTGCTGCTGCCATCTCGG - Intronic
1171496668 20:25561096-25561118 GGACTGTGCTGCTGCCATCTCGG + Intronic
1172209372 20:33186131-33186153 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1172717908 20:36977591-36977613 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1173754139 20:45500107-45500129 GTATTGTGCTGCTGCCAGCCTGG + Intergenic
1173852173 20:46226043-46226065 TGACTGTGCTGGTGTGAGCCAGG - Intronic
1174268290 20:49347855-49347877 TGTCTCTGCTGCTTCCCACCTGG - Intergenic
1174471385 20:50763648-50763670 TATTTGTGCTGCACCCAGCCTGG - Intergenic
1174732140 20:52928332-52928354 TCTCTGTGCTGCGGCCACCTGGG - Intergenic
1174961293 20:55160151-55160173 TGTGTGCAGTGCTGCCAGCCAGG + Intergenic
1175908342 20:62392785-62392807 TGTCTGTGCTGCTGCGATCCGGG + Intronic
1175910191 20:62401594-62401616 CGTGTGTGCTGCTTCCAGCTAGG - Intronic
1177171532 21:17661127-17661149 CGTCTTTGCTGGTGCCAGCTTGG + Intergenic
1178322578 21:31616580-31616602 TGTTTGTGCTACTGCATGCCAGG + Intergenic
1178419890 21:32435018-32435040 TGTCTGTGCTGCAGACATCATGG - Intronic
1178552695 21:33554520-33554542 TGACAGATCTGCTGCCAGCCCGG + Exonic
1178583540 21:33855314-33855336 TGACGCTGATGCTGCCAGCCTGG + Intronic
1178585949 21:33870962-33870984 TGGCTGTGCTGCAACCAGGCAGG - Intronic
1178857141 21:36259626-36259648 GGTCTGTGCTGCTGCAGGCTTGG + Intronic
1179569329 21:42268879-42268901 TGTATGTGCTTCCTCCAGCCAGG + Intronic
1179597568 21:42453020-42453042 TGTCAGGGCTGCTCCCAGCTGGG - Intergenic
1180023402 21:45143660-45143682 TAACTGTGCTGCTGTCAGACTGG + Intronic
1180039331 21:45268053-45268075 GGACTGTGCTGCTGCCATCTCGG + Intronic
1180056831 21:45363327-45363349 TGTCCCTGCCTCTGCCAGCCGGG - Intergenic
1180087308 21:45513590-45513612 TGGCTGTGCTGTGGTCAGCCTGG - Exonic
1180229590 21:46418903-46418925 TGTCTGTGATGGTGCCTGCCAGG + Intronic
1180869640 22:19138869-19138891 TGGGCGTGCAGCTGCCAGCCTGG + Intronic
1181022638 22:20111786-20111808 AGCCTGTGCTGATGCCATCCAGG + Exonic
1181795396 22:25305114-25305136 TTTCCTCGCTGCTGCCAGCCAGG - Intergenic
1181835934 22:25608631-25608653 TTTCCTCGCTGCTGCCAGCCAGG - Intronic
1182377551 22:29858903-29858925 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1182391738 22:30003056-30003078 TGCCTCTGCTGCTGCTAACCTGG + Intronic
1182828264 22:33284119-33284141 AGTGTGTGCTCCTGCCAGCCAGG + Intronic
1183003523 22:34880975-34880997 TGTAGGGGCTGCTGCCAGACAGG + Intergenic
1183238176 22:36635934-36635956 TGTCTCTGCTGCTGCCTTCCTGG + Intronic
1183939970 22:41288502-41288524 TTCCTGTGCTGCTTCCAGCTAGG + Intergenic
1185100593 22:48838914-48838936 TGCCTGTGCTGCAGGCATCCTGG - Intronic
949237091 3:1822493-1822515 GAGATGTGCTGCTGCCAGCCAGG + Intergenic
949330574 3:2917237-2917259 GGACTGTGCTGCTGCCATCTCGG - Intronic
949551304 3:5114591-5114613 GGACTGTGCTGCTGCCATCTCGG - Intergenic
949570146 3:5284660-5284682 GGACTGTGCTGCTGCCATCTCGG - Intergenic
949702855 3:6779397-6779419 TGTCTGTCCTGCAGCCACACGGG - Intronic
950762675 3:15247172-15247194 TTTATTTGCTGCTGACAGCCAGG - Intronic
953037635 3:39227121-39227143 GGACTGTGCTGCTGCCATCTCGG + Intergenic
953287868 3:41630358-41630380 TTTCCTTGCTGCTGCCAGCTAGG + Intronic
953431949 3:42847321-42847343 TTTCTGTGCTGTCCCCAGCCTGG - Intronic
955674714 3:61435654-61435676 GGACTGTGCTGCTGCCATCTCGG - Intergenic
955973357 3:64458081-64458103 GGGCTGAGCTGCGGCCAGCCAGG + Intergenic
956349395 3:68318017-68318039 TCACTGTGGTGCTGCCAGCTGGG + Intronic
956629687 3:71303943-71303965 TGTTTGTGAAGCTGCAAGCCTGG - Intronic
959992424 3:112644089-112644111 TGTCTGTGCTTCTGCCACAAAGG - Intronic
960534742 3:118803332-118803354 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
961646410 3:128395056-128395078 TCCCTGTGCTGCTGGCAGCATGG + Intronic
961823800 3:129588439-129588461 TGGCTCTGCTGCTTCCAGCTTGG - Intronic
962632210 3:137289655-137289677 TGCCTTTGCTGCTGCCAACATGG + Intergenic
964505579 3:157395372-157395394 GGTCTCTGCTGCTGGCAGACAGG + Intronic
964751523 3:160058302-160058324 TGTCTTTCCTGCTGGCAGACAGG - Intergenic
966577475 3:181518737-181518759 TGTGTGTGCTGCAGCCAAACAGG + Intergenic
966877911 3:184334004-184334026 TCTATGAGATGCTGCCAGCCAGG - Intronic
966967082 3:185004416-185004438 GGACTGTGCTGCTGCCATCTCGG - Intronic
967352024 3:188524644-188524666 TGTCTGTGTTGCTTCCAACAGGG + Exonic
967595482 3:191322985-191323007 TGTTTGTGCTTCTGCCATTCTGG + Intronic
967885330 3:194329823-194329845 TTTCTGTGCTGCTGACAACTGGG + Intergenic
968608469 4:1546426-1546448 TGGCTGTCCTGCTGAGAGCCTGG - Intergenic
968618753 4:1594096-1594118 TGGCTGCCCTGCTGGCAGCCTGG - Intergenic
968832569 4:2940702-2940724 TGTCTGTGGTGCTGACCCCCGGG - Intronic
969689280 4:8695198-8695220 TGCCTGTGCTGCCCCCACCCAGG - Intergenic
969820664 4:9717796-9717818 TGTCTGTGCTGCAGACATCATGG - Intergenic
971236111 4:24843894-24843916 TGTCTGTGCTCCAGCCATGCCGG + Intronic
972225683 4:37008434-37008456 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
972285723 4:37646074-37646096 TGTCTGTGCTTTAGCCAGCATGG - Intronic
972307322 4:37844025-37844047 TGACAGTGCTACAGCCAGCCCGG - Intronic
972640093 4:40917364-40917386 CGTCTCTGCTGCTTCCAGCCCGG - Intronic
972941171 4:44196986-44197008 TGACTGAGCTGCTCCTAGCCAGG + Intronic
973595886 4:52489573-52489595 TGTATGAGCTGCTGCCACCTGGG + Intergenic
975048532 4:69831272-69831294 TTTCTCTGCAGCTGCCAGCATGG + Intronic
975762104 4:77630837-77630859 TGGCTGTGTTGCTGCCAGGCAGG - Intergenic
975858503 4:78650581-78650603 TGTCTCTGCTGCAGCCACACTGG + Intergenic
976119353 4:81762680-81762702 TGACTCTGCAGCTGCCTGCCTGG + Intronic
977899545 4:102403811-102403833 TGTTTATGCTGCTAACAGCCTGG - Intronic
978947377 4:114515961-114515983 GGACTGTGCTGCTGCCATCTCGG + Intergenic
979270308 4:118752016-118752038 TGTCTTTGCTCCTGTCATCCAGG - Exonic
981677319 4:147357335-147357357 GGACTGTGCTGCTGCCATCTTGG + Intergenic
982045204 4:151438154-151438176 GGGCTGTTCTGCTGCCACCCAGG - Intronic
982788107 4:159559470-159559492 AGTCTCTGCTGCTGGCAGACTGG + Intergenic
983652908 4:170051508-170051530 TTTCTCTGCTGCTGCCATGCTGG + Intergenic
983796898 4:171875298-171875320 TTTCTGGGCTGCTCCCAGCCCGG - Intronic
984418140 4:179486751-179486773 TGTCTCTGCTGCTGGAAGACTGG + Intergenic
984431915 4:179661106-179661128 TGTCTGTGATTCAACCAGCCGGG - Intergenic
985674033 5:1221108-1221130 TGTCACTGCTGCTACCAGCTGGG - Intronic
985968713 5:3357849-3357871 TGTCCGCGCTGCTGCCGTCCCGG - Intergenic
987969034 5:24918120-24918142 TGTGTGTGTGTCTGCCAGCCTGG - Intergenic
988599987 5:32630933-32630955 TGTGTGTGGAGCTGCCAGCATGG + Intergenic
988602713 5:32654722-32654744 TGCCTGTGCTGATGGCAGCCAGG - Intergenic
989437908 5:41435942-41435964 TGCCTCTGCACCTGCCAGCCTGG + Intronic
990498448 5:56371993-56372015 GGACTGTGCTGCTGCCATCTTGG + Intergenic
990606353 5:57414301-57414323 TGTCTGTGATACTGCCACCCTGG - Intergenic
991295070 5:65071764-65071786 TGTCCCTGCTGCTTCCACCCTGG - Intergenic
992203040 5:74402681-74402703 TGTCTGTGATGTGGCCAGACTGG - Intergenic
992204834 5:74421334-74421356 TGTCTGCACTCCTGCCTGCCAGG + Intergenic
992463958 5:76985830-76985852 GGACTGTGCTGCTGCCATCTCGG - Intergenic
993939460 5:94040969-94040991 GGGCTGTGGTGCAGCCAGCCAGG + Intronic
993968139 5:94383146-94383168 CCTCTGGACTGCTGCCAGCCAGG + Intronic
995146123 5:108788240-108788262 CGCCTGTGCTGGTGCCTGCCTGG + Intronic
995895126 5:117002829-117002851 GGACTGTGCTGCTGCCATCTCGG - Intergenic
995942511 5:117600720-117600742 GGACTGTGCTGCTGCCATCTCGG - Intergenic
997026372 5:130066899-130066921 TGCCTGGGCTACTGCCAGCAAGG + Intronic
997243314 5:132324530-132324552 TGTCAGTGCTGGTCCCAGGCTGG - Intronic
997423267 5:133785921-133785943 GGTCTGTGCTGCTGTTAGCCAGG + Intergenic
999138106 5:149336932-149336954 ATTCTGTGCTGCTGCCAGACAGG - Intronic
999244642 5:150147406-150147428 TCCCCGGGCTGCTGCCAGCCCGG + Intronic
999604336 5:153297716-153297738 GGACTGTGCTGCTGCCATCTCGG - Intergenic
999938505 5:156515530-156515552 TGCCTGTGCTGCTCCCAGGTGGG - Intronic
1000046463 5:157525641-157525663 TGTCTTTGCTGTGGCCAGGCTGG - Intronic
1001138122 5:169119588-169119610 TGCTGCTGCTGCTGCCAGCCTGG - Intronic
1001810514 5:174624192-174624214 TGTCTGCACTTCTGCCAGACGGG + Intergenic
1002080771 5:176736171-176736193 TGGCTCTGCTGCTCCCTGCCTGG + Intergenic
1003202756 6:3977372-3977394 TGTCTCTGCTGTTGGCAGGCTGG + Intergenic
1003451885 6:6242471-6242493 TGTTTGTACTGCTGCCATCCTGG - Intronic
1006210073 6:32386029-32386051 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1006346466 6:33486499-33486521 GGACTGTGCTGCTGCCATCTTGG - Intergenic
1006432288 6:34004894-34004916 TGCTTTTGCTTCTGCCAGCCAGG + Intergenic
1007584269 6:42979073-42979095 TGGCAGTGCTGCTGCCACCCGGG - Exonic
1008406000 6:51119289-51119311 TGTCTGTGCTGCTTCTACCCAGG + Intergenic
1008624908 6:53306140-53306162 GGACTGTGCTGCTGCCATCTCGG - Intronic
1010018940 6:71137963-71137985 TCTCTCTTCTGCTTCCAGCCAGG - Intergenic
1010047072 6:71457840-71457862 TGTCTGTGCTGCTGCTTGTCTGG + Intergenic
1011476267 6:87752020-87752042 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1012991315 6:105929436-105929458 TGTCTCTGCTGCTAAGAGCCCGG - Intergenic
1013362039 6:109402786-109402808 AGGCTATGCTGCTTCCAGCCAGG + Intronic
1013667424 6:112362627-112362649 TGGCTGTGCTGCTGACTGGCCGG + Intergenic
1014014323 6:116512288-116512310 TCTCTGTGCTCCTTTCAGCCAGG + Intronic
1014137894 6:117908463-117908485 TCTCTTCGCTGCTCCCAGCCAGG - Intronic
1014717414 6:124882406-124882428 TGAGAGTGATGCTGCCAGCCAGG - Intergenic
1015589984 6:134813837-134813859 TGTCTGGGCTACTGCCTGCCAGG - Intergenic
1015632349 6:135244435-135244457 GCTCTGTGTTGCTGTCAGCCTGG + Intergenic
1015636116 6:135276083-135276105 GGTCTGTGGTACTTCCAGCCTGG + Intergenic
1016078331 6:139824734-139824756 TTGCTGAGCTGCTGGCAGCCTGG - Intergenic
1016366271 6:143321867-143321889 TGTCTGTGTTGCTGATAGACTGG + Intronic
1016610702 6:145985795-145985817 TATCTCTACTGCTACCAGCCTGG + Intergenic
1017991792 6:159495206-159495228 GGTATGTGCTGCTGTCCGCCTGG + Intergenic
1018528294 6:164736940-164736962 GGACTGTACTGCTGCCATCCCGG - Intergenic
1018826648 6:167412861-167412883 TTTCCTTGCTCCTGCCAGCCTGG + Intergenic
1019196113 6:170283978-170284000 TACCTGTGCCGCTGCCAGGCCGG - Exonic
1019588060 7:1815391-1815413 TGGGTTTGGTGCTGCCAGCCGGG + Intergenic
1020781176 7:12518560-12518582 TGTTTGTGCTGTTGGCAGCAAGG + Intergenic
1021120571 7:16790973-16790995 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1021761916 7:23910613-23910635 TGCCTGTGGTTCTCCCAGCCTGG - Intergenic
1022051880 7:26682966-26682988 TGTCTTTGTTGCTGAAAGCCTGG - Intronic
1022100022 7:27163989-27164011 TGTCTGTGCGTCTGTCTGCCAGG - Intronic
1022652504 7:32290120-32290142 TTCCTGTGCTGCTGGCAGACAGG - Intronic
1023074904 7:36473000-36473022 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
1023841551 7:44101272-44101294 TGTCTGAGCTGCTGCCATGGGGG + Intergenic
1024111151 7:46147242-46147264 AGTCTGAGATGCTGCCATCCAGG - Intergenic
1024307320 7:47939733-47939755 TGTCTGTGCTGGAGCCATCTCGG + Intronic
1024442344 7:49435263-49435285 TCTCTCTGCTCCAGCCAGCCAGG + Intergenic
1024883167 7:54112251-54112273 TTTCTGGGCTGCTGACTGCCTGG - Intergenic
1024974349 7:55099674-55099696 TGCCTGTGCAGCTCCCAGCCAGG - Intronic
1025220010 7:57099438-57099460 TTTGTATGCTGGTGCCAGCCGGG + Intergenic
1025231487 7:57205658-57205680 TGAATGTTCTGCTGCCAACCTGG + Intergenic
1025630790 7:63271019-63271041 TTTGTATGCTGGTGCCAGCCGGG + Intergenic
1026586370 7:71659337-71659359 AGTCTGGGCTGCGGTCAGCCAGG + Intronic
1027202786 7:76073724-76073746 TGTCTGGGCTGCCGCGAGGCAGG + Intergenic
1027645756 7:80795938-80795960 AGTCTGTGCTGGAGCCAGCATGG - Intronic
1028800543 7:94960197-94960219 TTTCTGTGCTTCTGCCAGATAGG - Intronic
1029298991 7:99563719-99563741 TGTCTATGCTGGTGGCATCCAGG + Intronic
1029430289 7:100524502-100524524 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1029711534 7:102302603-102302625 TGTCTGTGCAGATGCCCACCAGG - Intronic
1029734999 7:102460747-102460769 GGTCTTTGCTGATGCCACCCCGG + Intronic
1029991209 7:104964124-104964146 TGGCTGTGCTGCAGCCAAGCAGG - Intergenic
1031242052 7:119258118-119258140 AGTCTGTGTTACTGGCAGCCTGG + Intergenic
1031857752 7:126942576-126942598 GGTCTGTGCTACTGCTCGCCCGG + Intronic
1032290933 7:130590315-130590337 GGACTGTGCTGCTGCCATCTCGG + Intronic
1032705957 7:134421612-134421634 TATCTGGGCAGCTGCCAGCCAGG + Intergenic
1032944070 7:136829627-136829649 TCTTTGTGCTGCAGCCAGCATGG - Intergenic
1033219901 7:139520984-139521006 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1033332965 7:140431038-140431060 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1034245264 7:149639059-149639081 AGTCTGTCCTGCTGCCAGGGAGG - Intergenic
1034256680 7:149728583-149728605 TGCCTGTGCTGCGGCCTGCCTGG + Exonic
1034273327 7:149813633-149813655 TGCGTGTGGCGCTGCCAGCCTGG + Intergenic
1034346492 7:150388482-150388504 TACCTGTGCCGTTGCCAGCCAGG - Exonic
1034610901 7:152367377-152367399 TTTGTATGCTGGTGCCAGCCGGG - Intronic
1035059055 7:156055747-156055769 TGTCCATGCTGCTCGCAGCCTGG + Intergenic
1035374877 7:158401361-158401383 TCTCTGTGTTGCTGCCACCCAGG + Intronic
1035437660 7:158871255-158871277 TGTCTCTGCTCCTGGCATCCTGG - Exonic
1035458195 7:159023217-159023239 CGTCCGTGCTGCTGCAAGGCTGG + Intergenic
1035720867 8:1790775-1790797 TGTCTCTGCTGTTGTGAGCCGGG - Intergenic
1035810639 8:2488359-2488381 TCTCTGTCCTGCTTCCTGCCTGG - Intergenic
1035850482 8:2914822-2914844 GGTCTGGCCTGCTCCCAGCCGGG + Intergenic
1037090203 8:14905742-14905764 TGTCTATGCTGCTGCCCATCTGG - Intronic
1037675339 8:21046153-21046175 GGTCTGTTCTGATGTCAGCCAGG + Intergenic
1037691028 8:21181869-21181891 AGTCTGTGCTGGGGCCAGCTCGG - Intergenic
1038349666 8:26764315-26764337 TGGCTCTGCTGCTGCCATCTAGG + Intronic
1038613890 8:29075766-29075788 GGTTTGTGCTCCAGCCAGCCTGG - Intronic
1038690088 8:29753386-29753408 TCTCTGTGCTTGTGCCAGACTGG + Intergenic
1039761572 8:40582431-40582453 TGACAGTGCTACTGCCTGCCTGG + Intronic
1039915862 8:41859830-41859852 TGTTGTTGCTGCGGCCAGCCTGG - Intronic
1040463550 8:47673248-47673270 TGGCTGTGTTGCTGCAAGCTGGG + Intronic
1040510402 8:48088281-48088303 TATCTGTGCTTCTGACAGACTGG - Intergenic
1042593243 8:70418555-70418577 GGTCTCTGCTGCTGGCAGACTGG - Intergenic
1043062993 8:75528947-75528969 TTTCTCTCCTGCTGCCAGGCAGG - Intronic
1044591620 8:93917852-93917874 TGTCGCTGCTGCTGCCCGCGCGG + Intronic
1046732194 8:117737755-117737777 TGTGTGTGCAGCTTCCAGCAAGG - Intergenic
1047351791 8:124081083-124081105 TGTCTGGGCTGCTGCCCTCATGG - Intronic
1048368222 8:133756966-133756988 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1049196430 8:141318239-141318261 TGGCTGTGCTGATGCCACCCTGG + Intergenic
1049594244 8:143476140-143476162 TGTCTGTGGTCCTGACGGCCAGG - Intronic
1049802902 8:144526520-144526542 TTTCTGGGCTGCTTCCAGCTTGG - Exonic
1050534767 9:6622301-6622323 GGACTGTGCTGCTGCCATCTTGG + Intronic
1050557216 9:6799501-6799523 GGACTGTGCTGCTGCCATCTTGG - Intronic
1052246932 9:26347323-26347345 TGTCTGTTCTGGTGGCAGGCAGG - Intergenic
1052316972 9:27125354-27125376 AGACAGTGCTGTTGCCAGCCAGG + Intronic
1052359316 9:27537219-27537241 TGTCTGTGCTGCAGCGAGGGAGG + Intergenic
1053039616 9:34858588-34858610 TGTGTCTGTTGGTGCCAGCCTGG + Intergenic
1054784080 9:69193819-69193841 TGTCTTTGCTGCCCCCTGCCTGG + Intronic
1055708940 9:79037599-79037621 TGGCTGTGCTCCTGACAGGCCGG + Intergenic
1057092849 9:92275688-92275710 TGGCTGGGCTGCTTCCACCCAGG + Intronic
1057102687 9:92378024-92378046 TGTGTGTGCAGCTGCCATGCTGG + Intronic
1057813735 9:98278769-98278791 TGTCTGTTCCTCTGCCAGGCAGG + Intergenic
1060268010 9:122123392-122123414 TGGCTGTGGGGCTGCCAGGCAGG - Intergenic
1060321501 9:122565534-122565556 GGTCTCTGCTGCTGGCAGACTGG - Intergenic
1060806772 9:126582642-126582664 TCTCTGTGCTGCTGGCACCCTGG - Intergenic
1061014386 9:127973496-127973518 GGTCAGGGCTGCTGCCAGGCTGG + Intronic
1061870551 9:133518042-133518064 TGCCTGGGCTGCTGCAGGCCTGG + Intronic
1062200506 9:135300406-135300428 TGACTGTCCCGCTGCCAGCATGG - Intergenic
1062264777 9:135681949-135681971 TGTCTCTGCTGCAGCCTGCATGG + Intergenic
1185694492 X:2185079-2185101 TGTCTGTGGTGGGGCCATCCTGG - Intergenic
1186107785 X:6226233-6226255 TGTATGTGCTGCTGCTATCTCGG - Intronic
1186249133 X:7647052-7647074 TGTCTGTGCATCTGCCAGAAAGG - Intergenic
1186433036 X:9520898-9520920 TCTCTATGCTGCTGCTACCCAGG - Intronic
1186584118 X:10853026-10853048 TCTTTGTCCTGATGCCAGCCTGG + Intergenic
1187150009 X:16672673-16672695 GGGCTGTGGTGCAGCCAGCCGGG + Intronic
1189284934 X:39845352-39845374 TGTCTTTGCAGCTTGCAGCCTGG + Intergenic
1189968761 X:46396935-46396957 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1190171352 X:48114701-48114723 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1190241544 X:48660504-48660526 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1190967281 X:55312897-55312919 TGACTGTGATACTGCCAGGCTGG - Intergenic
1192221543 X:69200634-69200656 TGTCTGTGCTGTTGCTATGCAGG - Intergenic
1192477161 X:71452997-71453019 GGACTGTGCTGCTGCCATCTCGG - Intronic
1194644737 X:96445645-96445667 TGTATGTGCTTATGGCAGCCCGG + Intergenic
1194827595 X:98581865-98581887 TCTCAGGGCTGCTCCCAGCCAGG - Intergenic
1195203439 X:102571781-102571803 TGTATCTCCTGCAGCCAGCCAGG - Intergenic
1197617807 X:128714583-128714605 TGGCTGTGCTGCTGACTGGCAGG - Intergenic
1197815698 X:130495620-130495642 TGTCTTTGATGGAGCCAGCCGGG - Intergenic
1199541286 X:148960362-148960384 TGGCTGTGCTGCAGCCAAGCAGG - Intronic
1199553326 X:149079952-149079974 TGGCTGTACTGCAGCCAGGCAGG + Intergenic
1199616126 X:149657603-149657625 GGTCTGTGCTCCTGGCATCCTGG + Intergenic
1199626514 X:149745645-149745667 GGTCTGTGCTCCTGGCATCCTGG - Intergenic
1199711364 X:150471876-150471898 TGTTTGTCCTTCTGCCAGCAGGG - Intronic
1200279368 X:154763286-154763308 TGTCTGTGCTGCTGCCAGCCCGG + Intronic
1201405303 Y:13643937-13643959 GTTCTGTGCTGCTCCCAGGCAGG - Intergenic
1201554923 Y:15257634-15257656 TGTTAGGGCTGCTGCCAGCTGGG + Intergenic