ID: 1200280856

View in Genome Browser
Species Human (GRCh38)
Location X:154775754-154775776
Sequence CTCTAATGCCAGCAGCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 364}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200280856_1200280859 10 Left 1200280856 X:154775754-154775776 CCATGGAGCTGCTGGCATTAGAG 0: 1
1: 0
2: 2
3: 25
4: 364
Right 1200280859 X:154775787-154775809 CAGGTCTGCACTCAGAAACCGGG 0: 1
1: 0
2: 1
3: 16
4: 217
1200280856_1200280858 9 Left 1200280856 X:154775754-154775776 CCATGGAGCTGCTGGCATTAGAG 0: 1
1: 0
2: 2
3: 25
4: 364
Right 1200280858 X:154775786-154775808 ACAGGTCTGCACTCAGAAACCGG 0: 1
1: 0
2: 2
3: 9
4: 173
1200280856_1200280862 15 Left 1200280856 X:154775754-154775776 CCATGGAGCTGCTGGCATTAGAG 0: 1
1: 0
2: 2
3: 25
4: 364
Right 1200280862 X:154775792-154775814 CTGCACTCAGAAACCGGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 104
1200280856_1200280857 -9 Left 1200280856 X:154775754-154775776 CCATGGAGCTGCTGGCATTAGAG 0: 1
1: 0
2: 2
3: 25
4: 364
Right 1200280857 X:154775768-154775790 GCATTAGAGCACAGAATGACAGG 0: 1
1: 0
2: 0
3: 11
4: 108
1200280856_1200280861 12 Left 1200280856 X:154775754-154775776 CCATGGAGCTGCTGGCATTAGAG 0: 1
1: 0
2: 2
3: 25
4: 364
Right 1200280861 X:154775789-154775811 GGTCTGCACTCAGAAACCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 82
1200280856_1200280860 11 Left 1200280856 X:154775754-154775776 CCATGGAGCTGCTGGCATTAGAG 0: 1
1: 0
2: 2
3: 25
4: 364
Right 1200280860 X:154775788-154775810 AGGTCTGCACTCAGAAACCGGGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200280856 Original CRISPR CTCTAATGCCAGCAGCTCCA TGG (reversed) Intronic
900596260 1:3481498-3481520 CTCTTCTGCCTGCAGCTCCCAGG - Intergenic
901049194 1:6418001-6418023 CTCAAATTCCTGCTGCTCCATGG + Exonic
901747081 1:11381049-11381071 CTGTAATCCCAGCTGCTCAAGGG - Intergenic
901916806 1:12506379-12506401 CTCTAAGCTCAGCACCTCCAGGG - Intronic
902046641 1:13529766-13529788 CTTTCATGCCAGCAGCCCCAGGG - Intergenic
902376090 1:16030500-16030522 CTCAAAGGCCAGCAGCGCCGTGG - Exonic
902381020 1:16052237-16052259 CTCGAAGGCCAGCAGCGCCGTGG - Exonic
903006568 1:20302749-20302771 CTTCAATGCCACCACCTCCATGG - Intronic
905329045 1:37179322-37179344 CTCTGATGCCACCTGCCCCATGG - Intergenic
910310361 1:85816832-85816854 CTGAAATGCCATCTGCTCCATGG + Exonic
910708796 1:90157305-90157327 ATCTCAGGCCAGGAGCTCCAAGG - Intergenic
911104941 1:94122160-94122182 CTTAAATGCCATCACCTCCAAGG - Intergenic
912836764 1:113003475-113003497 CTGTAATCCCAGCTACTCCAGGG - Intergenic
913026839 1:114852089-114852111 CTGTAATCCCAGCTACTCCAGGG + Intergenic
913277763 1:117155789-117155811 CTCAAATGCCAGCTTCTCCAGGG + Intronic
913940422 1:125098667-125098689 TTCTCATGCCATCACCTCCAAGG - Intergenic
913955000 1:143281551-143281573 TTCTCATGCCACCACCTCCAAGG - Intergenic
913982440 1:143533890-143533912 TTCTCATGCCACCACCTCCAAGG + Intergenic
915128899 1:153683752-153683774 CACCAAAGCCAGCACCTCCAGGG - Exonic
915626886 1:157119307-157119329 CTCAGATGCCATCACCTCCACGG - Intergenic
917751947 1:178061491-178061513 CTCTTATGCAAGCAGCAACAAGG + Intergenic
918293963 1:183137665-183137687 CTAGAATGCCACCAGCACCAAGG + Exonic
918659425 1:187071667-187071689 CTGTAATCCCAGCAGCACCTTGG - Intergenic
919144420 1:193615460-193615482 TTCTAATGCCAGCATCTTAAGGG + Intergenic
919836065 1:201574340-201574362 TTCTCATGCCACCTGCTCCACGG - Intergenic
920928648 1:210366491-210366513 CTGTAATCCCAGCTACTCCAGGG + Intronic
921524495 1:216200857-216200879 CTCCAATGCAAACAGCCCCATGG - Intronic
924613562 1:245592962-245592984 CTCCAATGCCAGGAAATCCAGGG - Intronic
924899063 1:248375058-248375080 CTATAATGCCAGCAGTTTCGGGG + Intergenic
1063098716 10:2931267-2931289 TTCTGGTGCCAGCATCTCCAGGG + Intergenic
1063854773 10:10237320-10237342 CTCTAATACCAGCTACTCGAGGG - Intergenic
1064472320 10:15649030-15649052 GTCTAATGCCATCTCCTCCATGG - Intronic
1065426176 10:25606311-25606333 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1066578075 10:36848416-36848438 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1066779719 10:38931167-38931189 TTCTCATGCCACCACCTCCATGG + Intergenic
1066951492 10:42122455-42122477 TTCTCATGCCACCACCTCCAAGG - Intergenic
1067111351 10:43403266-43403288 CTTTAATCCCAGCAGGGCCAAGG - Intronic
1067801646 10:49363141-49363163 CTTCAAGGCCAGGAGCTCCACGG - Intergenic
1069705120 10:70454363-70454385 CTGTAGTCCCAGCAACTCCAGGG + Intergenic
1071481135 10:86065770-86065792 ATCAAATGCTTGCAGCTCCAAGG + Intronic
1071980331 10:90998830-90998852 TTCTAGTTCCAGCTGCTCCATGG + Intergenic
1072237494 10:93465989-93466011 CTCACATGCCAGCTGCCCCAGGG - Intronic
1072572921 10:96674160-96674182 CACTAAGGCCAGCAACTCCTGGG - Intronic
1072704240 10:97668804-97668826 CTCTGATGACAGCACCTCCTGGG + Intronic
1073013139 10:100377324-100377346 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1073059650 10:100725783-100725805 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1075020463 10:118948471-118948493 CTATAATCCCAGCTGCTCCGGGG + Intergenic
1077119589 11:900697-900719 CTCCAAAGCCAGCACCTCCTTGG - Intronic
1078150038 11:8750643-8750665 CTTTAGTGCCACCAGCTCCGTGG + Exonic
1078157996 11:8815145-8815167 CTCTCAGGCCAGCAGCTCCAAGG + Intronic
1078524394 11:12089648-12089670 GTCTAATTTCAGCAGCTCCTGGG - Intergenic
1079087482 11:17457044-17457066 CTCAAATGTCACCTGCTCCAGGG - Intronic
1081343284 11:41953480-41953502 TTTTTATGACAGCAGCTCCAGGG + Intergenic
1083714883 11:64569505-64569527 CTCTAATGCCACCTCCTCCACGG - Intronic
1083797624 11:65026674-65026696 CTGTAATTCCAGCTACTCCAGGG - Intronic
1084084722 11:66849785-66849807 CTCCAGTGCCTGCAGATCCAGGG + Exonic
1085124511 11:73990243-73990265 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1088727576 11:112653288-112653310 ACCTAATGCCAGAAGCTCCAGGG + Intergenic
1089163214 11:116455442-116455464 CACTAAGCCCAGCAGCTCCTGGG - Intergenic
1089387194 11:118076144-118076166 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1089559310 11:119335748-119335770 AGCTGAGGCCAGCAGCTCCAGGG - Exonic
1089999544 11:122943130-122943152 CTGTAATCCCAGCAGCTCAAGGG - Intronic
1090063202 11:123481330-123481352 CTCTAATTCCAGCTACTCCGAGG + Intergenic
1090132036 11:124153660-124153682 CTGTAATGCCAGCAACTCGGAGG - Intergenic
1092691538 12:11116455-11116477 CTCTAAAGCCATCTGCTCCCAGG - Intronic
1092819791 12:12342614-12342636 ATCCTATGCCACCAGCTCCAAGG + Intronic
1094594504 12:31852404-31852426 CTCTATAGACAGCAGCCCCAAGG - Intergenic
1095726175 12:45455436-45455458 CTCTAAAGCCAGGACCTCAAGGG - Intergenic
1096741732 12:53698414-53698436 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1097970581 12:65628866-65628888 CTCCACTGACAGCACCTCCAGGG - Intergenic
1098260516 12:68665376-68665398 CTCCAATGTCAGTAACTCCAAGG - Exonic
1099064569 12:77957787-77957809 CTGTAATCCCAGCTACTCCAGGG - Intronic
1100823082 12:98449828-98449850 CTATAATCCCAGCAGCTGGAGGG + Intergenic
1101145641 12:101838207-101838229 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1103838080 12:123840023-123840045 CCCAAATGCCAGCAGCGCCGAGG - Intronic
1103866300 12:124054677-124054699 CTCCAGTGCCACCAGCTCCACGG - Intronic
1104727317 12:131085997-131086019 CTCTGATCACAGCAGCTCCCGGG + Intronic
1105233802 13:18526585-18526607 TTCTCATGCCACCACCTCCATGG + Intergenic
1105527609 13:21190648-21190670 CTCTCATGGCAGCATCTCCAGGG + Intergenic
1106135758 13:26972249-26972271 CTCAAATGCCACCTGCTCCAGGG - Intergenic
1106690664 13:32111969-32111991 CTCTAATGCAAGCATTTGCAAGG + Intronic
1106770763 13:32958742-32958764 CTGTTAGGCCAGCAGCTTCAGGG + Intergenic
1107175150 13:37391282-37391304 CTGTAATTCCAGCAGCTCGGAGG - Intergenic
1107924919 13:45249791-45249813 CTCTAATGCAATCAGCTCTCAGG - Intronic
1112018177 13:95348830-95348852 CTCTCATGCTATCAGCTCCTTGG - Intergenic
1113246140 13:108397882-108397904 CACTACTGCCAGGACCTCCAGGG - Intergenic
1113835051 13:113323184-113323206 CTCTAATGTCTGCAGCTCAAGGG + Exonic
1113952156 13:114077929-114077951 TTCTGATGCCATCACCTCCAAGG + Intronic
1113988803 13:114341801-114341823 AGCTAATGCCAGTGGCTCCAAGG - Intergenic
1115603787 14:34980482-34980504 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1116210679 14:41939095-41939117 CTGTAATCCCAGCTACTCCATGG - Intergenic
1119027243 14:71163968-71163990 CTCTGATGCCACCCTCTCCAAGG + Intergenic
1121074782 14:91059679-91059701 TTCTAAAGCCATCATCTCCAGGG + Intronic
1122671043 14:103372681-103372703 CTTTGAGGCCAGCAGCCCCACGG + Intergenic
1122903517 14:104791743-104791765 ATCTCATGCCAGCAGCCCCCCGG - Intronic
1202937533 14_KI270725v1_random:105082-105104 TTCTCATGCCACCACCTCCATGG - Intergenic
1123395681 15:19932813-19932835 TTCTCATGCCACCACCTCCAAGG + Intergenic
1124858931 15:33418940-33418962 CTTTATTTCCAGAAGCTCCAAGG + Intronic
1125118408 15:36122837-36122859 CTTAAATGCCAGCCCCTCCATGG - Intergenic
1125424780 15:39537746-39537768 CTCCATGGGCAGCAGCTCCATGG + Intergenic
1125627781 15:41122866-41122888 CTGTAATCCCAGCAGCTACTTGG - Intergenic
1126469264 15:48990010-48990032 CTCTTCTGCCAGCAAATCCAAGG - Exonic
1126808226 15:52374717-52374739 CTCTCCTTCCAGAAGCTCCAGGG - Intronic
1127566412 15:60193525-60193547 CTGTAGTGCCAGCTACTCCAGGG - Intergenic
1128396839 15:67235168-67235190 CTCACATGTCAGCTGCTCCATGG - Intronic
1128937588 15:71760359-71760381 CTCTAAAGCCAGAAACTCCTTGG - Intronic
1129322850 15:74784154-74784176 CAAAACTGCCAGCAGCTCCAAGG - Intronic
1130438260 15:83924692-83924714 CTCTGTAGCCAGCAGCACCAGGG - Intronic
1132544427 16:526925-526947 CTCTCCTGCCAGCAGCTGCTGGG - Intergenic
1132868024 16:2103450-2103472 CTCTGAGGCCAGCCGCTCGATGG + Exonic
1132892126 16:2209644-2209666 CTGCACTGCCAGCAGCTCCTGGG + Exonic
1133296228 16:4753812-4753834 CCCAAATGCCAGCAGCACCAAGG + Intronic
1133931562 16:10236847-10236869 CTCCAATGGCAGAAGCTGCAAGG + Intergenic
1134233993 16:12451369-12451391 CTCTAATACTCCCAGCTCCATGG - Intronic
1134523749 16:14929674-14929696 CTCTGAGGCCAGCCGCTCGATGG - Intronic
1134549152 16:15131262-15131284 CTCTGAGGCCAGCCGCTCGATGG + Intronic
1134711340 16:16328159-16328181 CTCTGAGGCCAGCCGCTCGATGG - Intergenic
1134719191 16:16371461-16371483 CTCTGAGGCCAGCCGCTCGATGG - Intergenic
1134948236 16:18340424-18340446 CTCTGAGGCCAGCCGCTCGATGG + Intergenic
1134955489 16:18380534-18380556 CTCTGAGGCCAGCCGCTCGATGG + Intergenic
1135058099 16:19247487-19247509 CTGTAATCCCAGCAGCACCTTGG - Intronic
1135399498 16:22156384-22156406 CTCAAATGACATCAGCTCCCTGG + Exonic
1136008845 16:27349205-27349227 CTCCACTGCCTGCAACTCCAGGG - Intronic
1136047031 16:27623097-27623119 CTCAAATGCCACCCCCTCCAAGG + Intronic
1136698135 16:32104994-32105016 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136769470 16:32822869-32822891 TTCTCATGCCACCACCTCCAAGG - Intergenic
1136798633 16:33048279-33048301 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136935690 16:34461805-34461827 TTCTCATGCCACCACCTCCAAGG - Intergenic
1136939737 16:34511652-34511674 TTCTCATGCCACCACCTCCAAGG - Intergenic
1136946019 16:34652139-34652161 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136948864 16:34690701-34690723 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136956347 16:34791171-34791193 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136960083 16:34836912-34836934 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136964128 16:34886765-34886787 TTCTCATGCCACCACCTCCAAGG + Intergenic
1136968272 16:34941348-34941370 TTCTCATGCCACCACCTCCAAGG + Intergenic
1137093274 16:36221222-36221244 TTCTCATGCCACCACCTCCAAGG + Intergenic
1137219871 16:46438016-46438038 TTCTCATGCCACCACCTCCAAGG - Intergenic
1138132921 16:54497209-54497231 CTCTAATCCCAGCTACTCGAAGG - Intergenic
1138309920 16:56014795-56014817 CTCTTATGTGAGCAGCTCCATGG - Intergenic
1138407439 16:56807897-56807919 CTGTAATCCCAGCTACTCCAGGG + Intronic
1138740341 16:59301499-59301521 CTCAAGTGCCTGCAGATCCAAGG - Intergenic
1139582252 16:67880582-67880604 CTCCACTTCCTGCAGCTCCAGGG - Exonic
1139651540 16:68364791-68364813 GTCAAATGCCACCAGCTCCTCGG + Exonic
1139875465 16:70142547-70142569 CTCCAATGCCAGGAGGTCTACGG - Exonic
1139875557 16:70143354-70143376 CTCCACTGCAAGAAGCTCCAGGG - Intronic
1140360226 16:74337757-74337779 CTCCACTGCAAGAAGCTCCAGGG + Intergenic
1140360319 16:74338562-74338584 CTCCAATGCCAGGAGGTCTACGG + Intergenic
1141417968 16:83891463-83891485 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1142400703 16:89856941-89856963 CTGTAATCCCAGGTGCTCCAGGG + Intronic
1203071887 16_KI270728v1_random:1084974-1084996 TTCTCATGCCACCACCTCCAAGG - Intergenic
1142654863 17:1384828-1384850 CTCTAATCCCAGCTACTCCCAGG - Intronic
1142897045 17:2987482-2987504 CTGTAATCCCAGCTGCTCGAGGG - Intronic
1143326298 17:6100620-6100642 CCCAAATGCCAACAGATCCAAGG - Intronic
1143599762 17:7936825-7936847 TTCTAATGCCATATGCTCCAGGG - Intronic
1144176567 17:12713204-12713226 CTCTGATGCCAGGAGCACAAAGG - Intronic
1144695033 17:17297921-17297943 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1145097801 17:20046682-20046704 CTCAAATGTCAGCATCTCAATGG - Intronic
1145692303 17:26755225-26755247 TTCTCATGCCACCACCTCCAAGG + Intergenic
1146723111 17:35137156-35137178 CTATGTGGCCAGCAGCTCCAAGG - Exonic
1147028182 17:37607832-37607854 CTGTAATCCCAGCTGCTCCGAGG + Intronic
1147839807 17:43363343-43363365 CGCTAATGCCGGCAGCGCCTTGG - Intergenic
1151306546 17:73266331-73266353 CTGTAATCCCAGCTGCTCGAGGG - Intergenic
1151572702 17:74935247-74935269 CCCAAATGCCATCTGCTCCATGG - Intergenic
1152212647 17:79010474-79010496 CTCTCCTGCCAGAGGCTCCACGG - Intergenic
1203183824 17_KI270729v1_random:92776-92798 TTCTCATGCCACCACCTCCAAGG + Intergenic
1154519214 18:15208863-15208885 TTCTCATGCCACCACCTCCATGG - Intergenic
1155714287 18:28920953-28920975 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1157308681 18:46535691-46535713 CTGTAATCCCAGCTACTCCAGGG - Intronic
1157834322 18:50885262-50885284 CTCTAATCCCAGCAACTCACAGG + Intronic
1159050775 18:63419289-63419311 CTGTAATCCCAGCTGCTACATGG + Intronic
1159163546 18:64674289-64674311 CTCTAATGCAAGAAGTTCAAGGG - Intergenic
1159959463 18:74544357-74544379 CTCTCATGACATAAGCTCCATGG - Intronic
1161258263 19:3321670-3321692 CTCAAATGTCACCATCTCCAGGG - Intergenic
1161903816 19:7139948-7139970 CTATAATCCCAGCTGCTCCTCGG - Intronic
1162112553 19:8407829-8407851 CTGTAATCCCAGCTACTCCAGGG + Intronic
1162195852 19:8984119-8984141 CTGTAATTCCAGCTACTCCAGGG - Intergenic
1162201536 19:9024229-9024251 CTCTGAAGCCAGAAGCCCCATGG + Intergenic
1162711113 19:12595637-12595659 TTTTAATGCCACCAGTTCCATGG - Intronic
1162749468 19:12819755-12819777 CTGTAATCCCAGCTACTCCAGGG + Intronic
1162943735 19:14030077-14030099 CTGTAATCCCAGCACTTCCAGGG - Intronic
1163584195 19:18155262-18155284 CTCTACTCCCAGCAGCTCCAAGG + Intronic
1164635336 19:29787439-29787461 CTCAAATGCCACCTCCTCCAGGG - Intergenic
1165061557 19:33207452-33207474 CTCCACTGCCAGCAGCACCCTGG + Exonic
1165324205 19:35104736-35104758 CTCTGATGCCAACAGCTTAATGG + Intergenic
1166215561 19:41332274-41332296 CTCTCCTGCCTGCAGCTCCACGG - Exonic
1166365245 19:42274855-42274877 CTCTTATCCCATCAGCTCCATGG - Intronic
1202671952 1_KI270709v1_random:63327-63349 TTCTCATGCCACCACCTCCAAGG + Intergenic
1202682297 1_KI270712v1_random:18089-18111 TTCTCATGCCACCACCTCCAAGG + Intergenic
928502066 2:31906817-31906839 CTCAAATGCCTCCAGCCCCAGGG + Intronic
931309310 2:61063819-61063841 CTGTAATACCAGCTACTCCAAGG - Intergenic
933267184 2:80193723-80193745 CTCTAATTCCTGGAGCTCTAAGG - Intronic
933739003 2:85518245-85518267 CTGTAGTTCCAGCTGCTCCAGGG - Intergenic
933807597 2:86011665-86011687 CTCTGATGGCACCAGCTCCTGGG + Intergenic
933830188 2:86200787-86200809 CTGTAATCCCAGCTACTCCAAGG - Intronic
934249481 2:90336992-90337014 TTCTCATGCCACCACCTCCAAGG - Intergenic
934260097 2:91466466-91466488 TTCTCATGCCACCACCTCCAAGG + Intergenic
937253740 2:120540561-120540583 CAGTAATGCCGCCAGCTCCAGGG - Intergenic
938067254 2:128287828-128287850 CTCTCCTGCCTGCTGCTCCAAGG + Intronic
938183977 2:129211682-129211704 CTCTAATCCAAGCAGCTACTCGG - Intergenic
938519211 2:132049498-132049520 TTCTCATGCCACCACCTCCATGG - Intergenic
938560058 2:132464314-132464336 CTCTAAGGACACCAGCTTCAAGG - Intronic
938981295 2:136529748-136529770 CACTGATGCCTGCAACTCCATGG - Intergenic
939403363 2:141724347-141724369 CTCTTTTACCAGCAGCTACATGG - Intronic
942479120 2:176363589-176363611 CTATAATGACAGCAGATCAAGGG + Intergenic
942596143 2:177593606-177593628 CTTCAAAGGCAGCAGCTCCAAGG - Intergenic
943040792 2:182802582-182802604 CTCAAACATCAGCAGCTCCAAGG - Intergenic
943626232 2:190203305-190203327 AACTAATGCCCACAGCTCCAAGG - Exonic
946387061 2:219389705-219389727 CTGTAATCCCAGCAGCTACTTGG + Intronic
946435031 2:219645862-219645884 CTTTAATGCCAGCAATTCCAGGG + Intergenic
946587934 2:221211298-221211320 CTCAAATGCCACCACCTTCATGG + Intergenic
946797173 2:223367640-223367662 CTCAAATGCAAGCAGCCACATGG + Intergenic
946836948 2:223782133-223782155 CTGTAATCCCAGCTACTCCAGGG - Intronic
947714217 2:232331762-232331784 CTCTGACGCCATCACCTCCAAGG + Intronic
947733427 2:232443141-232443163 CTCTGACGCCATCACCTCCAAGG + Intergenic
947772447 2:232681512-232681534 CTCAGGTGTCAGCAGCTCCAGGG + Intronic
1169551017 20:6701274-6701296 CTCTAATGCCTGCGGTTTCAAGG - Intergenic
1170348986 20:15418979-15419001 CTCTACTGCCAGCCACACCAAGG + Intronic
1170728086 20:18947838-18947860 CTCCAATGCCAGCCTTTCCAGGG - Intergenic
1172736385 20:37128988-37129010 CTCTAATGTCAGCCCCTCCCAGG - Intronic
1173962893 20:47088830-47088852 CTGTAATCCCAGCACCTCCAAGG - Intronic
1175134819 20:56815340-56815362 CTGTAATGCCAGCTACTCCGGGG - Intergenic
1176585794 21:8584066-8584088 TTCTCATGCCACCACCTCCAAGG + Intergenic
1176777787 21:13154862-13154884 TTCTCATGCCACCACCTCCATGG + Intergenic
1177921811 21:27162040-27162062 TACTAATGCCAGAAGCCCCAGGG + Intergenic
1180268603 22:10560965-10560987 TTCTCATGCCACCACCTCCAAGG + Intergenic
1181019403 22:20091096-20091118 CCCGAATGCCAGCAGCACCCGGG - Intronic
1181152831 22:20897402-20897424 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1181329663 22:22080041-22080063 CACTGGTTCCAGCAGCTCCAAGG + Intergenic
1181386041 22:22546597-22546619 CTGCAATGCCAGCAGCCTCATGG + Intergenic
1181393113 22:22598412-22598434 CTCTATGTCCAGCAGCTCCCAGG + Intergenic
1181421537 22:22802710-22802732 CCCTGAGGCCATCAGCTCCAGGG + Intronic
1181497346 22:23295010-23295032 CTCAAATTCCTGCAGCCCCAAGG - Exonic
1182541635 22:31046212-31046234 CTCAAATGCCACCTCCTCCAAGG - Intergenic
1182990611 22:34763905-34763927 ATCTTATGCCATCAGCTGCAAGG + Intergenic
1183184365 22:36283412-36283434 CTGTAATCCCAGCTACTCCAGGG + Intronic
1183481541 22:38068181-38068203 CTCTCCTGCCATCAGCTCCCAGG + Intronic
1184917763 22:47583988-47584010 TTCTAATGCCACAATCTCCAAGG - Intergenic
1185331149 22:50252545-50252567 CTCCAATGCCAGCAGGTCCCTGG - Intronic
1203290135 22_KI270735v1_random:28687-28709 TTCTCATGCCACCACCTCCATGG - Intergenic
1203322990 22_KI270737v1_random:86689-86711 TTCTCATGCCACCACCTCCAAGG - Intergenic
950569653 3:13792150-13792172 CCCTACTGCCACCAGCCCCAGGG + Intergenic
950672528 3:14535832-14535854 CTGTAATGCCTGCAGCCCCGGGG + Intronic
951605839 3:24434071-24434093 CTCTAGTGCCAACTGCTCCTAGG + Intronic
951616968 3:24557678-24557700 CTCAAATGTCAGTAGTTCCATGG + Intergenic
951792915 3:26506204-26506226 CTCTATGGCCAGCAGCCACAGGG - Intergenic
953235486 3:41102810-41102832 CTCCAATCCCACCAGCTTCAGGG + Intergenic
953407191 3:42665286-42665308 CTCTGCTGCCAGCAGGCCCAGGG + Exonic
953560478 3:43986520-43986542 CTGTAAAGCCATCAGGTCCAGGG + Intergenic
954132230 3:48566668-48566690 CTCTCTCGCCAGGAGCTCCAGGG + Exonic
956415962 3:69029564-69029586 CTGTAATCCCAGCAGCTCGGAGG - Intronic
957204310 3:77175277-77175299 TTCTAAAGCCAACAGCTTCATGG - Intronic
959186025 3:103049231-103049253 CTCTTATTCTAGCAGCTCCTTGG - Intergenic
960235737 3:115279887-115279909 CTCTAATGACACCAGCTTCAAGG - Intergenic
960620238 3:119630229-119630251 TTCTACTGCCAGTAGCTTCAGGG - Intergenic
961135749 3:124509329-124509351 CTGTAATCCCAGCAGCTCTGGGG - Intronic
962531877 3:136289113-136289135 CTATAATCCCAGCAACTCAAGGG - Intronic
963401192 3:144801991-144802013 CACTTTTGCCAGCATCTCCAGGG - Intergenic
966014800 3:175129059-175129081 CTCTAGTCCCAGCTACTCCAGGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
966917567 3:184593437-184593459 GTCCCATGCCAACAGCTCCAGGG + Intronic
968374459 4:27488-27510 AACTAATGCCAGTGGCTCCAAGG + Intergenic
972699921 4:41483786-41483808 CTCAAATGTCAGCCGCTCAAGGG + Intronic
975471125 4:74769576-74769598 CACTAATTCAAGCATCTCCAAGG + Intronic
977846956 4:101777987-101778009 CTATAAAGCCAGCTGCTTCAGGG + Intronic
977878891 4:102181655-102181677 CTGTAATCCCAGCTACTCCAGGG + Intergenic
978575994 4:110190625-110190647 CTGTAATCCCAGCTACTCCAGGG - Intronic
979019790 4:115481702-115481724 CTATCATGACAGCAGCACCAAGG - Intergenic
979304791 4:119130082-119130104 CTGTAATTCCAGCAGCTACTCGG - Intergenic
979679958 4:123448511-123448533 CTGTAATCCCAGCTACTCCAGGG - Intergenic
980928560 4:139162973-139162995 CTGTAATCCCAGCTACTCCAGGG + Intronic
981745012 4:148044467-148044489 GTCAGATGCCAGCAGCTCCCTGG - Intronic
982825689 4:160001674-160001696 CTCTGATGCCCACAGCACCAGGG + Intergenic
982942304 4:161573608-161573630 CTGTAATCCCAGCTACTCCAGGG + Intronic
983579294 4:169291953-169291975 CTATAATCCCAGCTACTCCAGGG - Intergenic
984648683 4:182246231-182246253 CACCACTGCCAGCAGCCCCAAGG + Intronic
984768605 4:183418948-183418970 CTCTCAGGCCAGCTGCTCCGGGG + Intergenic
985378328 4:189365526-189365548 CTCGGATGCTAGCAGCTCCCTGG - Intergenic
986032508 5:3907435-3907457 CTCTAATTCTGACAGCTCCAGGG + Intergenic
988353852 5:30147133-30147155 CTCAAATGCCAGGTGCTCCTGGG + Intergenic
989012207 5:36885676-36885698 CTCTAAAGCCATCAGCAGCAAGG - Intronic
989146211 5:38252601-38252623 CACTTAGGACAGCAGCTCCAGGG - Intergenic
990476291 5:56164360-56164382 CTCTAATACAGGCAGCTCCAGGG - Intronic
990730560 5:58804262-58804284 TTCAAATGCCAGGAGCCCCATGG + Intronic
991281071 5:64914076-64914098 CTCTAATTCCAGCACCATCATGG - Intronic
991347149 5:65681712-65681734 CTCTAATCCCAGCAGCACTTTGG + Intronic
992027323 5:72682985-72683007 CTGTAATCCCAGCTACTCCAGGG + Intergenic
992782674 5:80142353-80142375 CTGTAATGCCAGCTACTCGAAGG - Exonic
993024951 5:82634622-82634644 CTCAAAAGCCATCTGCTCCAAGG - Intergenic
995016365 5:107314117-107314139 CTCTAAGGTCAGCAACTCAAGGG - Intergenic
995215335 5:109588778-109588800 CTCTAAAGTCAGCAGCAGCAAGG - Intergenic
996059438 5:119016475-119016497 CTGTAATCCCAGCTACTCCACGG + Intergenic
998057190 5:139088092-139088114 CTCCAGTGGCAGCAGCTCCACGG - Intronic
998793127 5:145787660-145787682 CTATAATCCCAGCTGCTCCGGGG - Intronic
999318161 5:150597452-150597474 CTGTAATCCCAGCTACTCCAGGG - Intergenic
999800287 5:155027168-155027190 CTCAAATTCCAGCTGCTCCTTGG + Intergenic
1001919895 5:175591465-175591487 CTGTAATCCCAGCCGCTCCTGGG + Intergenic
1001935089 5:175697931-175697953 CTCAAATGCCACCTGCTCCATGG + Intergenic
1002074223 5:176698507-176698529 CTCTTCTGGCACCAGCTCCAAGG + Intergenic
1002303206 5:178269231-178269253 CTTTAATGGTAGCAGCTCCTTGG + Intronic
1002645675 5:180652455-180652477 CTGTAATCCCAGCTTCTCCAGGG - Intergenic
1002755444 6:155537-155559 AGCTAATGCCAGTGGCTCCAAGG + Intergenic
1003490663 6:6618733-6618755 CTCTTATGCCAGCATTTCCTCGG - Intronic
1005428699 6:25731184-25731206 CTCAAATTCCAGCAGTTCAAGGG + Intergenic
1007330454 6:41102905-41102927 CTCTAATACCAGCAACTTCTGGG + Intergenic
1007441361 6:41863878-41863900 CTATAATCCCAGCTGTTCCAAGG - Intronic
1007710355 6:43819127-43819149 CTATAATCCCAGCTACTCCAGGG + Intergenic
1008166310 6:48142866-48142888 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1008705511 6:54153727-54153749 CTGTAATCCCAGCGACTCCAGGG + Intronic
1009320713 6:62285719-62285741 CTCTAAGGCGAGCATCTTCAGGG + Intronic
1009955108 6:70444278-70444300 CTGTAATCCCAGCTACTCCAGGG + Intronic
1011622385 6:89255313-89255335 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1013427992 6:110032558-110032580 CTCTAATGACAGCAATTACAGGG - Intergenic
1013676659 6:112471381-112471403 CTCTGCTGGCAGCAGCTCCAGGG - Intergenic
1014381070 6:120743188-120743210 TTCTAATGCCACCACCTCAAGGG - Intergenic
1014703844 6:124722506-124722528 CTCTAATGCCTGCTGATCCAAGG - Intronic
1015815980 6:137211218-137211240 CCCAAATGCCAGCAGTGCCAAGG + Intronic
1020125687 7:5531409-5531431 CTCAAAAGCAGGCAGCTCCAGGG - Intronic
1020366524 7:7386642-7386664 CTCTTGTGCCTGCAGCTCCCAGG - Intronic
1021178209 7:17474938-17474960 CTCTTATGCGAGCAGCAACAGGG + Intergenic
1022619748 7:31971017-31971039 CTGTAATCCCAGCTACTCCAGGG + Intronic
1023303674 7:38800711-38800733 CTGTAATCCCAGCTACTCCAGGG + Intronic
1024101065 7:46033381-46033403 AGCCAATGCCAGCAGCACCAGGG - Intergenic
1024658651 7:51473192-51473214 CTCTCATCCCTGCAACTCCAAGG - Intergenic
1024805319 7:53132575-53132597 TTCTCATGCCACCACCTCCATGG - Intergenic
1024991637 7:55239265-55239287 CACTAAAGCCAGGAGCTCCATGG + Intronic
1025474710 7:60905106-60905128 TTCTCATGCCACCACCTCCAAGG + Intergenic
1025480859 7:60981170-60981192 TTCTCATGCCACCACCTCCAAGG + Intergenic
1025488179 7:61077861-61077883 TTCTCATGCCACCACCTCCAAGG - Intergenic
1025512293 7:61584768-61584790 TTCTCATGCCACCACCTCCAAGG - Intergenic
1025565793 7:62432587-62432609 TTCTCATGCCACCACCTCCAAGG + Intergenic
1026947245 7:74324602-74324624 CTCTGCTGCCACCATCTCCAAGG - Intronic
1027853108 7:83473968-83473990 CTGTAGTCCCAGCTGCTCCAAGG + Intronic
1027947892 7:84774068-84774090 CTCTATTTCCAGCAGCTCTAGGG + Intergenic
1030082001 7:105786307-105786329 CTCTTATGCCAAGAGCCCCAGGG + Intronic
1030269568 7:107655878-107655900 CTGTAATGCCAGCTACTTCAGGG + Intergenic
1033340259 7:140486436-140486458 CTGTAATCCCAGCTGCTCCCAGG - Intergenic
1034041913 7:147886596-147886618 CTCAAATGCCAGTAGCACCCTGG - Intronic
1039836481 8:41260325-41260347 CTCTGATGCCAGCAGTTCACGGG - Intergenic
1040285923 8:46100333-46100355 CTCTCATGCCAGAAGCCCCCAGG - Intergenic
1040286483 8:46103117-46103139 CTTTCATGCCAGAAGCTCCCAGG - Intergenic
1040290031 8:46119533-46119555 CTCTGATCCCAGAAGCCCCAGGG - Intergenic
1040292474 8:46132479-46132501 CTCCCATCCCAGAAGCTCCAGGG - Intergenic
1040306666 8:46215488-46215510 CTCTAATCCCAGAAGCCCCCAGG + Intergenic
1040324565 8:46335222-46335244 CTCTCATCCCAGAAGCTCCCAGG + Intergenic
1040334288 8:46408255-46408277 CTCCAATCCCAGAAGCCCCAGGG + Intergenic
1042068511 8:64904769-64904791 CTATAATGCCAGCTACTCGAGGG - Intergenic
1043322803 8:79010836-79010858 CTGTAATGTCAACAACTCCATGG + Intergenic
1045679002 8:104639032-104639054 CTGTAATCCCAGCTACTCCAAGG + Intronic
1045759515 8:105587746-105587768 CCAAAATGCCAGCAGCACCAAGG - Intronic
1045861869 8:106822595-106822617 CTCTAATGCCAACAGAACCTGGG - Intergenic
1047663558 8:127065094-127065116 CTGTAATGCCAGGAGCCACATGG - Intergenic
1048710009 8:137199319-137199341 CTCTACTGCCATGAGTTCCAGGG - Intergenic
1048959887 8:139567692-139567714 CTCTGATGCCTTCAGCTACAGGG + Intergenic
1049248138 8:141573697-141573719 CACTCAAGCAAGCAGCTCCACGG - Intergenic
1049653559 8:143787981-143788003 CTCTCCAGCCAGCAGCTCCTCGG + Intergenic
1052995953 9:34551777-34551799 CTCCAATGCCAGCGACTCCCAGG - Exonic
1053435392 9:38070223-38070245 CTGTAATCCCAGCAGCTACTCGG + Intergenic
1053526688 9:38837329-38837351 GTTTACTGACAGCAGCTCCAGGG + Intergenic
1053698492 9:40662319-40662341 TTCTCATGCCACCACCTCCAAGG - Intergenic
1053944492 9:43292554-43292576 TTCTCATGCCACCACCTCCAAGG - Intergenic
1054198916 9:62061764-62061786 GTTTACTGACAGCAGCTCCAGGG + Intergenic
1054309781 9:63461720-63461742 TTCTCATGCCACCACCTCCAAGG - Intergenic
1054408569 9:64785870-64785892 TTCTCATGCCACCACCTCCAAGG - Intergenic
1054441724 9:65269685-65269707 TTCTCATGCCACCACCTCCAAGG - Intergenic
1054488560 9:65751813-65751835 TTCTCATGCCACCACCTCCAAGG + Intergenic
1054639438 9:67526603-67526625 GTTTACTGACAGCAGCTCCAGGG - Intergenic
1059723771 9:116986399-116986421 CGCTAATGCCAGCTGCTTGAAGG - Intronic
1060036208 9:120257964-120257986 CTGTAATGCGAGAAGCTGCAAGG - Intergenic
1060129834 9:121085533-121085555 CTGAATTCCCAGCAGCTCCATGG - Intronic
1060582279 9:124760187-124760209 CTGTAATCCCAGCTGCTCCAGGG + Intronic
1061584105 9:131555148-131555170 CTCAAATGCCCCCACCTCCAGGG - Intergenic
1062056635 9:134472443-134472465 CACTACTGTCAGCAACTCCAGGG - Intergenic
1062141620 9:134962175-134962197 CTCTCAGGCCAGCAGCAGCAAGG + Intergenic
1202780855 9_KI270717v1_random:35524-35546 TTCTCATGCCACCACCTCCAAGG - Intergenic
1203574764 Un_KI270744v1:166663-166685 AACTAATGCCAGTGGCTCCAAGG - Intergenic
1203587628 Un_KI270747v1:21132-21154 TTCTCATGCCACCACCTCCAAGG - Intergenic
1203615696 Un_KI270749v1:61585-61607 TTCTCATGCCACCACCTCCAAGG + Intergenic
1185557162 X:1030539-1030561 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1185907822 X:3953040-3953062 CATTCATGGCAGCAGCTCCACGG - Intergenic
1188325075 X:28791996-28792018 CTATAAAACCAGCAGCACCATGG + Intronic
1189615002 X:42774187-42774209 CTGTAATCCCAGCCACTCCAGGG + Intergenic
1189869446 X:45367172-45367194 CTATAATGACAGCAACACCAAGG + Intergenic
1190396756 X:49993055-49993077 CTCTAATGCCAGAAGTTCACAGG - Intronic
1190864819 X:54375621-54375643 CTGTAATCCCAGCTGCTCCGGGG - Intergenic
1190958935 X:55226267-55226289 ATCTCATGCCAGCAAATCCAAGG - Intronic
1192963828 X:76156676-76156698 CTCTTGTGCCACCAGCACCAAGG + Intergenic
1194348198 X:92792998-92793020 CTCTAATACCAGCAGTTGGAAGG + Intergenic
1194512246 X:94811267-94811289 CTCTAGTTCCAGCACTTCCATGG + Intergenic
1197640967 X:128967671-128967693 CCAGAATCCCAGCAGCTCCAGGG + Intergenic
1199107444 X:143887086-143887108 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1200280856 X:154775754-154775776 CTCTAATGCCAGCAGCTCCATGG - Intronic
1200656528 Y:5909627-5909649 CTCTAATACCAGCAGTTGGAAGG + Intergenic